Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>25) - curl.sai.msu.ru/ )

• Index of /pub/mirror/opensuse/distribution/

... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы . Курсы факультетов МГУ . Факультет иностранных языков и регионоведения . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ...

Еще в разделе: (Показать все результаты (>3) - distant.msu.ru/ )

Dmitriy Mendeleev . ... Dmitry Ivanovich Mendeleev : A project of undergraduate students from School No.470 (St.Petersburg) . ... Brokhaus Online: Biography of Mendeleev in Russian . ... Original Periodic Table by Mendeleev . ... Mendeleev's "Principles of Chemistry" (4 Pts. in 2 Vols) . ... Mendeleev's house museum in the village Boblovo, Moscow region (in Russian) . Statue of Mendeleev in front of Chemistry Department at Moscow State University (from the article about Russian chemistry in Chem. ...

Еще в разделе: (Показать все результаты (>124) - www.chem.msu.ru/ )

• THE EFFECT OF CATALYST ON INTERMOLECULAR HETEROGENEITY DISTRIBUTION IN
• Семинар "Перспективные наноматериалы"
• CURRICULUM VITAE

... It is being organized jointly by the Byurakan Astrophysical Observatory (BAO) and the Armenian Astronomical Society (ArAS). ... LIST OF LECTURERS AND LECTURES : Dr. Vladimir AIRAPETIAN (Goddard Space Flight Center, USA): Physics of Winds from Cool Evolved Stars Dr. Don BARRY (Cornell University ... (observation techniques and theory) Dr. Michel DENNEFELD (Institut d'Astrophysique de Paris, France): Introduction to spectroscopic observations Dr. Serguei DODONOV (Special Astrophysical ...

Еще в разделе: (Показать все результаты (>88) - sai.msu.ru/ )

• Презентация PowerPoint
• General Catalogue of Variable Stars: Description

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... 13-Aug-2014 12:13 106K lk_20140815_0905.tar.. 15-Aug-2014 09:06 106K lk_20140901_0823.tar.. 01-Sep-2014 08:23 103K lk_20141016_1324.tar.. 16-Oct-2014 13:25 103K lk_20141211_1708.tar.. 11-Dec-2014 17:08 103K lk_20150430_0315.tar.. 30-Apr-2015 03:15 103K lk_20150430_0420.tar.. 30-Apr-2015 04:20 103K lk_20150818_1511.tar.. 18-Aug-2015 15:11 104K lk_20151113_1903.tar.. 13-Nov-2015 19:04 105K lk_20160314_0610.tar.. 14-Mar-2016 06:11 105K . ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

• The NMW survey homepage

MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 15, 2013 1 - The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2013" 1. ... Administrative law 2. ... Members of the Council of Experts: Golichenkov Alexander Konstantinovich (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) Romanov Stanislav Vladimirovich (Deputy Dean on instructional work, Candidate in Law, Docent). ...

Еще в разделе: (Показать все результаты (>3) - www.law.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....

Еще в разделе: (Показать все результаты (>31) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION

CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...

Еще в разделе: (Показать все результаты (>20) - www.inorg.chem.msu.ru/ )

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>3) - hsmi.msu.ru/ )

• Admission committee | MSU Higher school of management and innovation
• We are assembling training courses! | MSU Higher school of management and

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>8) - pk.math.msu.ru/ )

• Information | Mechmath admission for internetional students

... Архитектура пакета . ... Пакет содержит типы данных и алгоритмы для поддержки теории формальных языков в системе Maple. ... Для представления символов используется тип type/character , Для представления цепочек тип type/string . ... Основной новый тип: Language . ... Каталог с исходными текстами пакета имеет следующую структуру. src\ . ... Конструкторы и утилиты к типу Language . ... Конструкторы и утилиты к типу Acceptor . ... конструкторы объектов имеют префикс new , например: newLanguage() . ...

Еще в разделе: (Показать все результаты (>4) - al.cs.msu.ru/ )