... Lomonosov Moscow State Univ Research Center "Computer Science and Control" of RAS (FRC CSC RAS) Operations Research Society (RSORS) will organize the VIII Conference in Octo Operations Research. theoretical aspects and ersity (MSU), Federal and Russian Scientific ber 2016 in Moscow. ... Deadline for abstract submissions is March 31, 2016. ... Conference website: http://io.cs.msu.ru/ORM2016.html. ... Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>20) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2016/ORM2016-2nd_announ-ENG.pdf
• Кафедра Исследования Операций

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>4) - physcontrol.phys.msu.ru/ )

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>64) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Geometric methods in optimal control theory | Department: General Problems of

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...

Еще в разделе: (Показать все результаты (>16) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/guidetomarketresearch.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...

Еще в разделе: (Показать все результаты (>166) - genhis.philol.msu.ru/ )

Supernova 2005cs in M51 . This page is devoted to information on Supernova 2005cs in NGC 5194 (= M51 ). ... Information on the original web pages for many of these images can be found on the updates and links web pages. Discovered by amateur Wolfgang Kloehr (Germany) [ Translate ]. ... SNWeb has a 2005cs page . ... Sky and Telescope news release on Supernova 2005cs . ... 2005/01/ . ... mirror . W. Kloehr image . ... Joel Nicolas image . ... Wolfgang Kloehr image . ... 2006/01/06.504 . ...

Еще в разделе: (Показать все результаты (>426) - www.rochesterastronomy.org/ )

• Supernova 2009js in NGC 918
• Supernova 2002fk in NGC 1309
• Supernova 1999gi in NGC 3184

... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...

Еще в разделе: (Показать все результаты (>4) - smu.physics.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>40) - eng.geogr.msu.ru/ )

• Faculty of geography Lomonosov Moscow State University
• Department of Cartography and Geoinformatics
• Undergraduate study

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>165) - www.pereplet.ru/ )

• About this document ...

... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б  . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>34) - ecfs.msu.ru/ )

• Resources | ECFS
• News | ECFS
• Archive news | ECFS

SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...

Еще в разделе: (Показать все результаты (>92) - mouse.belozersky.msu.ru/ )

• NPG-explorer
• PDB entries containing domains of the family "Ribbon-helix-helix protein, copG
• 1QPI biounits

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf
• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_2.pdf
• http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_1.pdf

. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.

177. Ученые ? детям

178. http://scon155.phys.msu.su/~swan/cyrtug2000.pdf

179. Russian Roulette / Русская Рулетка

180. Hotel "69 Parallel" - Guestbook