... about ERC . education . research . ... Statutes of ERC . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate and coordinate efforts of MSU units aimed at research and development and education in nanotechnology and nanosystems. ... ERC activities conform to the current legislation, regulatory documents of the Ministry of Education and Science of the Russian Federation and the Federal Agency for Education, the Charter of MSU, and these Statutes. ...
APPLIED PROBLEMS Identification of Inorganic Salts and Determination of Their Concentrations in Aqueous Solutions Based on the Valence Raman Band of Water Using Artificial Neural Networks S. A. Burikov, T. A. Dolenko, V. V. Fadeev, and A. V. Sugonyaev Physics Faculty, Moscow State University ... .msu.su, tdolenko@radio-msu.net, fadeev@lid.phys.msu.su, sugonjaev@lid.phys.msu.su Abstract--The characteristic features of the valence Raman band of ...
The Department of Talented Youth Affairs and Professional Orientation . ... Posted on 24.06.2014 by admin . The first business networking ?to attract investment in the field of electronics? will be held July 10 at the Moscow State University with the participation of the body of scientific groups MSU, representing the Department of Physics, Department of Materials Science and Mechanics and Mathematics Faculty, companies belonging to the Group of Companies ?Rostech? and ?Innopraktika?. ...
... Поиск по МГУ | Лента новостей | ... Работа | ... Форумы > Новости МГУ > Тема . ... Работы в области фундаментальных наук, выполненные в сотрудничества с учеными ГАИШ МГУ, удостоены премии Киото . ... Она вручается, начиная с 1985 года за достижения в 3 областях: в области высоких технологий, в области фундаментальных наук и в области философии и искусства. ... Эти работы получили развитие в исследованиях школы академика Сюняева. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...
... О кафедре . ... Учебные пособия . ... Язык Паскаль: Учебно-методическое пособие. ... Языки управления приложениями: Учебно-методическое пособие. ... Учебно-методическое пособие для студентов 2 курса, обучающихся по направлению Фундаментальные информатика и информационные технологии . ... Учебное пособие для студентов 1 курса. ... Учебное пособие для студентов II курса. 2009 (с исправлениями от мая 2014). ... Учебно-методическое пособие для студентов 1 курса. ... кафедра АЯ ВМК МГУ, 2009 2014 ...
... структурная морфология растений, морфология цветка, теоретическая ботаника, биотехнология (клональное микроразмножение in vitro ). ... Чуб В.В. 'Роль позиционной информации в регуляции развития органов цветка и листовых серий побегов'. ... Чуб В.В., Юрцева О.В. Математическое моделирование формирования цветка у представителей семейства Polygonaceae. ... Choob V.V., Penin A.A. Structure of Flower in Arabidopsis thaliana : Spatial Pattern Formation// Russian Journal of Developmental Biology (Ontogenez...
Uneex . SeminarRouting . ... Топология сети . иерархия построения (в каждом месте сети только то, что нужно именно в этом месте) . ... Динамическая маршрутизация. ... Что неможет статическая. требования, предьявляемые к маршрутизации . достоинства и недостатки каждого вида маршрутизации . ... принцип функционирования . архитектура сети . реализация в UNIX системах . ограничения . OSPF . ... архитектура сети, автономные системы, политика маршрутизации . ... RFC 1388 . ...
... Host City . ... Aug 31, 10.00 Excursion to Dmitrov . Excursion to Dmitrov Visit the ancient Russian town of Dmitrov and shake hands with Yuri Dolgoruki, a medieval Russian prince, who incidentally happens to be also the founder of the city of Moscow. Dmitrov known as the Moscow's Nohern pearl is just 65 kilometers north of Moscow on the suburban road. ... Dmitrov finally entered the Moscow county in the 16th century, after a lengthy internal struggle among its princes. ...
... Otherwise we will never recognize you and your homeworks. ... Afterwards you can go ahead and upload your homework to the system. You can also find your rating. ... To upload Homework - choose the corresponding task and press "Submit". labadmin's blog . ...
Universit Bocconi would like to inform you about its international study opportunities. Founded in 1902 and located in Milan (Italy), Bocconi is recognized as one of Europe's leading universities for economics and management. ... DIEM (International Economics and Management) . ... These programs, together with a distinguished international faculty, a modern urban campus as well as students from all over the world guarantee a lively and stimulating study environment. ...
... Доктор Ван Слайк также является профессором Высшей школы управления Университета Маастрихта (Нидерланды); членом Национальной академии государственного управления (г. Вашингтон, США). В 2007 г. он был удостоен премии Beryl Radin за лучшую статью, опубликованную в Journal of Public Administration Research and Theory (издательство Oxford University Press ). ... Brown Trevor, Matthew Potoski and David M. Van Slyke. ... Lecy Jesse D. and David M. Van Slyke. ... Ashley Shena R. and David M. Van Slyke . ...
... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... In the commercial world, the business manager (entrepreneur, Chief Executive Officer (CEO), Chief Operating Officer (COO):) must create the infrastructure and face many issues specific to the establishment and development of a new company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... Механико-математический факультет . ... Профессор Соколов Дмитрий Дмитриевич (род. 1949) окончил Физический факультет МГУ по кафедре математики в 1972г. и аспирантуру этой кафедры в 1975 году с кандидатской диссертацией. ... Область научных интересов проф. Д.Д.Соколова составляют: . ... Как профессор кафедры Д.Д.Соколов читает спецкурс "Быстрое динамо в случайном потоке", а также руководит студентами и аспирантами. 6 учеников Д.Д.Соколова стали кандидатами физико-математических наук. ...