... use of several physical disks to run each PC GAMESS/Firefly process so that each copy uses only its own HDD. ... The LAM/MPI version 7.1.X. Note that the PC GAMESS/Firefly is not compatible with older LAM/MPI versions e.g., 6.5.9. ... Please consult with the LAM/MPI documentation and manual pages before start experimenting with parallel PC GAMESS/Firefly runs. The LAM/MPI-linked PC GAMESS/Firefly binaries should present on all the computers you plan to run the PC GAMESS/Firefly in parallel . ...

Еще в разделе: (Показать все результаты (>111) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel Linux/MPICH binaries

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>159) - www.intsys.msu.ru/ )

... User installation and start of CalcHEP session . ... Model installation . The name of the received file which you have copied from the CalcHEP WWW page should be . ... The directory models is used for files which describe models of particle interactions. ... It has to show the path to CalcHEP directory which is used to dowload the file with compiler flags. d) read README file attached to the model and make the corresponding changes in Makefile if it needs. e) launch 'gmake' inside MODEL . ...

Еще в разделе: (Показать все результаты (>12291) - theory.sinp.msu.ru/ )

• [Comphep-common] latex problem in 4.5.1
• Scheme of calls in the CompHEP session
• Files and commands in the working directory

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... This is a modification of the original Camera Calibration Toolbox for Matlab by Jean-Yves Bouguet that adds automatic calibration object detection to the functions of the original toolbox. ... The source code can be downloaded lower in this page. v0.31b Download GML Matlab Camera Calibration Toolbox 0.31 11.05.2005 Re-compiled and added correct OpenCV dlls . ... C++ Camera Calibration Toolbox . ...

Еще в разделе: (Показать все результаты (>347) - graphics.cs.msu.ru/ )

• GML MatLab Camera Calibration Toolbox | Лаборатория компьютерной графики и
• Saliency Map Estimation | Graphics and Media Lab
• Keyframe-based Depth Compression (Update) | Graphics and Media Lab

... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 > FAQ . ... What to do in case of problems . Whom do I contact for support? ... Check the errorlog! Apache tries to be helpful when it encounters a problem. ... The latest version of the Apache Frequently-Asked Questions list can always be found at the main Apache web site. Check the Apache bug database . Most problems that get reported to The Apache Group are recorded in the bug database . ...

Еще в разделе: (Показать все результаты (>687) - itpm.msu.su/ )

• The Inner Workings of uucico
• Issues Regarding DNS and Apache - Apache HTTP Server
• Layout of UUCP Transfers and Remote Execution

... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 > FAQ . ... What to do in case of problems . Whom do I contact for support? ... Check the errorlog! Apache tries to be helpful when it encounters a problem. ... The latest version of the Apache Frequently-Asked Questions list can always be found at the main Apache web site. Check the Apache bug database . Most problems that get reported to The Apache Group are recorded in the bug database . ...

Еще в разделе: (Показать все результаты (>2812) - uneex.lorien.cs.msu.su/ )

• Frequently Asked Questions - Apache HTTP Server
• Relocatable Wrinkles: Things to Consider
• Issues Regarding DNS and Apache - Apache HTTP Server

... About Trac . ... Important note: Please use either version 1.6, 2.4 or later of mod_wsgi . ... тАЛ mod_wsgi is an Apache module for running WSGI-compatible Python applications directly on top of Apache. ... environ [ 'TRAC_ENV' ] = '/usr/local/trac/mysite' os . environ [ 'PYTHON_EGG_CACHE' ] = '/usr/local/trac/mysite/eggs' import trac.web.main application = trac . ... Note: using mod_wsgi 2.5 and Python 2.6.1 gave an Internal Server Error on my system (Apache 2.2.11 and Trac 0.11.2.1). ...

Еще в разделе: (Показать все результаты (>5923) - kodomo.cmm.msu.ru/ )

• Help: bisect

... Any - Head of the Department Deputy Head of the Department Scientific Secretary Secretary Professor Docent Senior Lecturer Assistant Professor Senior Researcher Researcher Junior Researcher . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>160) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of
• Riutin Konstantin Sergeevich | Department: General Problems of Control. Faculty
• About us | Department: General Problems of Control. Faculty of Mechanics and

... To prevent the shell from expanding an argument containing several special characters: $ sed -e 1,$s/V[0-9].*: //p /etc/motd sed: command garbled: 1,/V[0-9].*: $ sed -e '1,$s/V[0-9].*: //p' /etc/motd DYNIX/ptx(R) Tue Feb 25 12:04:15 GMT 1993 . ... To prevent the shell from expanding special characters but allow command substitution: echo 'My working directory is `pwd`' My working directory is`pwd` echo "My working directory is `pwd`" My working directory is /home/jane/docs . ...

Еще в разделе: (Показать все результаты (>865) - comet.sai.msu.ru/ )

• Logging out
• Examples of using the cp command
• Switching to another account

This page could be summarized with the statement: don't require Apache to use DNS for any parsing of the configuration files . ... In order for Apache to function properly it absolutely needs to have two pieces of information about each virtual host: the ServerName and at least one IP address that the server responds to. ... use IP addresses in Listen . ... In any event it doesn't seem possible to reliably boot a virtual-hosted web server when DNS has failed unless IP addresses are used. ...

Еще в разделе: (Показать все результаты (>691) - rtm-cs.sinp.msu.ru/ )

• IPMasquerading+Napster mini-HOWTO
• NT OS Loader + Linux mini-HOWTO
• MICO Specific Exception Handling

This page could be summarized with the statement: don't require Apache to use DNS for any parsing of the configuration files . ... In order for Apache to function properly it absolutely needs to have two pieces of information about each virtual host: the ServerName and at least one IP address that the server responds to. ... use IP addresses in Listen . ... In any event it doesn't seem possible to reliably boot a virtual-hosted web server when DNS has failed unless IP addresses are used. ...

Еще в разделе: (Показать все результаты (>125) - neptun.sai.msu.ru/ )

• Compiling Apache under UnixWare

Network Working Group A. McKenzie Request for Comments: 1110 BBN STC August 1989 A Problem with the TCP Big Window Option Status of this Memo This memo comments on the TCP Big Window option described in RFC 1106. ... Abstract The TCP Big Window option discussed in RFC 1106 will not work properly in an Internet environment which has both a high bandwidth * delay product and the possibility of disordering and duplicating packets. ... The uniqueness of the sequence number corrects for data duplication. ...

Еще в разделе: (Показать все результаты (>25878) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1110.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc775.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc775.txt.pdf

Электронная библиотека Попечительского совета . ... Shorter L.R. - Problems And Worked Solutions In Vector Analysis . ... Название: Problems And Worked Solutions In Vector Analysis . Автор: Shorter L.R. Язык: . ... Angle between two vectors 98 . ... Problem in force and work 185 . Problem in force and work, on gravitational attraction 282 . ... Products, scalar and vector, of two axial vectors 127 . ... Unit vector 8 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>26491) - lib.mexmat.ru/ )

• Lebedev N.N., Davis F.A., Skalskaya I.P. - Worked Problems in Applied
• ?im?a J., Kuc?ra R., Herman J. - Counting and Configurations: Problems in
• Brown I.J., Dooley K. - Cisco Cookbook :: Электронная библиотека

Browser-based rename, move, and delete for individual topics . ... How to Rename/Move/Delete a Topic . Deleted Topics: How to Clear the Trash . ... You can use browser-based controls to change a topic's name, move it to another TWiki web, or delete it to a hidden Trash web. ... Move/Delete: Select the target web if other than the current web - choose Trash to delete a topic . ... Deleted topics are moved to a special Trash web - they are NOT physically erased from the server. ...

Еще в разделе: (Показать все результаты (>50367) - dualopt1.cmm.msu.ru/ )

• ManagingTopics - TWiki - TWiki
• %TOPICTITLE% (5 vs. 6) - TWiki

... Give an example of chemical reaction between a salt and an acid leading to the formation of another salt and a base. (1 point) [Solution] . ... Write the reactions of chromium (III) bromide with hydrogen peroxide in acidic and basic media. (2 points) [Solution] . ... In the reactions, specify the structures of all substances. (3 points) [Solution] . ... Three substances A, B, and C were mixed in the amount of three moles each. ... Example problems in chemistry for the entrance exams ( main round ) ....

Еще в разделе: (Показать все результаты (>760) - chem.msu.ru/ )

• Entrance Examinations - Main Round
• Science Department
• V.V. Lunin, V.G. Nenajdenko,O.N. Ryzhova, N.E. Kuz'menko "CHEMISTRY of 21st

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) . ... L.S.Pontryagin, P.S.Alexandrov and A.N.Kolmogorov . ... Photo by A.I.Pontryagina In the beginning of the 50s, L.S. went into (broadly understood) theory of ordinary differential equations, which had episodically drawn his interest earlier. ...

Еще в разделе: (Показать все результаты (>51) - pont2008.cmc.msu.ru/ )

... Perhaps the plugin is installed, but did you remember to enable it in configure? ... Note that you can have the installer re- check dependencies by executing it with the dependencies option from the server: cd /path/to/my/ foswiki / $ perl GenPDFAddOn_installer dependencies CGI, =0,cpan,May be required for lib/ Foswiki /Contrib/GenPDF.pm Data::Dumper, =0,cpan,May be required for lib/ Foswiki /Contrib/GenPDF.pm Error , =0,cpan,May be required for lib/ ... foswiki IRC on freenode . ...

Еще в разделе: (Показать все результаты (>48971) - wiki.cmc.msu.ru/ )

• VarADDTOZONE < System < Foswiki
• WikiSyntax < System < Foswiki

... Perhaps the plugin is installed, but did you remember to enable it in configure? ... Note that you can have the installer re- check dependencies by executing it with the dependencies option from the server: cd /path/to/my/ foswiki / $ perl GenPDFAddOn_installer dependencies CGI, =0,cpan,May be required for lib/ Foswiki /Contrib/GenPDF.pm Data::Dumper, =0,cpan,May be required for lib/ Foswiki /Contrib/GenPDF.pm Error , =0,cpan,May be required for lib/ ... foswiki IRC on freenode . ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• SafeWikiPlugin < System < Foswiki
• PatchFoswikiContrib < System < Foswiki

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>70) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• Change-points at different levels of the hierarchy of EEG segmental...
• Change-points in EEG components with different pattern

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>30) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search