... MSU Graphics & Media Lab (Video Group) . The algorithm allows to increase video frame rate (fps) by the factor equal to any integer number. ... Frame rate conversion is done as shown on the picture below: . ... arbitrary whole number of interpolated frames between reference frames. ... Segmentation of original frames with detection of areas with complex motion allows to avoid visual degradation of interpolated frames even on scenes with hard motion. ... Video Frame Rate Double Up-Conversion . ...

Еще в разделе: (Показать все результаты (>471) - graphics.cs.msu.ru/ )

• Video Frame Rate N-Times Up-Conversion | Лаборатория компьютерной графики и
• Video Frame Rate Double Up-Conversion | Graphics and Media Lab
• Video Frame Rate Double Up-Conversion | Лаборатория компьютерной графики и

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>100) - www.intsys.msu.ru/ )

Team . Team has been working in the field of geoinformation technology more than 20 years. Members of the team have fundamental knowledge and experience both in modern information technology and in seismology. ... Information technology for developing of the map of maximum possible magnitudes (M max ) of expected earthquakes. Information technology for detection of earthquake precursors. ... The technology is supported by geoinformation system named Geo 2.5 . ...

Еще в разделе: (Показать все результаты (>658) - geo.web.ru/ )

• COMAGMAT MODEL

... A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. The force field parameters are developed which describe the structure of b-diketonate-, aqua-, and mixed aqua-b-diketonate complexes with good accuracy; the same parameters are applicable to various coordination numbers/polyhedra. For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>1096) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 52, No. 3, P. 175 (2011)
• Structure and Interaction Energies of the Ar...Cl2 Complex. Application of the
• Conjunction of thermal lens spectrometry and high-performance liquid

... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>36) - analyt.chem.msu.ru/ )

• Molecular mechanics study of the mixed-ligand lanthanide complexes using
• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by

... Criteria of branch quality . As it was repeatedly told , phylogenetic trees consist from branches. ... I. e., those positions, which can separate sequences of the branch from other sequences in the alignment. ... Measure of branch separation . ... Here and further: A - branch of the tree, i , j - sequences of alignment . ... That's why number of conserved positions in some branch should be considered in complex with the distribution of conserved positions in the whole alignment. ...

Еще в разделе: (Показать все результаты (>6369) - monkey.belozersky.msu.ru/ )

• 1FJL biounits

Электронная библиотека Попечительского совета . ... Mangano S. - XSLT Cookbook . ... Название: XSLT Cookbook . ... The 136 solutions to commons problems address string processing, mathematics, dates and times, document traversal, XML queries, HTML, scalable vector graphics, code generation, debugging, and generic programming. ... automation, code generation, XSLT from XSLT . ... Code . ... code, generation, XSLT from XSLT . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>17289) - lib.mexmat.ru/ )

• Wollmann J. - Wave Propagation in Viscoelastic and Anisotropic, Cylindrical
• Knopp K., Bagemihl F. - Infinite Sequences and Series :: Электронная библиотека
• Ng E.W. - A Comparison of Computational Methods and Algorithms for the Complex

... The Scenario Machine method to calculate evolution of binary stars is basically a Monte-Carlo method for statistical simulation of large ensembles of stellar binary systems originally used by Kornilov & Lipunov (1983) for massive binaries and developed later by Lipunov & Postnov (1987) for low-mass binaries (for the most recent review, see Lipunov, Postnov &Prokhorov, 1996 (LPP96)). ... This is not the first example of the WWW representation of the stellar evolution. ... Fri Jun 21 19:17:07 MSD 1996...

Еще в разделе: (Показать все результаты (>435) - xray.sai.msu.ru/ )

• The Model

Application of evolutionary model in the evaluation of the quality of pair wise alignment of amino acid sequences Valery Polyanovsky, V. G. Tumanyan Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia ... : polyanovskyvo@mailfrom.ru, tuman@eimb.ru The purpose of the work is to develop a universal method for estimating the pairwise alignment quality depending on the evolutionary distance (degree of homology) between the ... REFERENCES 1. ...

Еще в разделе: (Показать все результаты (>313) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/126.pdf

Computation of contribution from the cavity effect to protein-ligand binding free energy" . Grigoriev F.V., Jabin S.N., Romanov A.N., Sulimov V.B. Some results of the study of the cavitation effect, which provides an essential part of hydrophobic interactions due to the formation of protein-ligand complexes, are discussed. ... The main contribution to the cavitation effect is due to the annihilation of the cavity of the ligand. ... PostScript (in Russian) (14.1MB) . PDF (in Russian) (697KB) . ...

Еще в разделе: (Показать все результаты (>564) - num-meth.srcc.msu.ru/ )

• "Sink-algorithms for the simulation of electron transfer kinetics"
• "The TECONV program complex to automate transformations of large collections of
• "A language for a tool set oriented to interactive processing of complex data

Hide Zen home . ... We realized original spatial algorithm for 2-dimensional data with spherical attributes in open-source database PostgreSQL, which allow us to work with terabyte-sized data. ... The total number of objects in our database is about 4 billions (10^9) objects. ... Large scale survey projects produce huge amount of data, which needs to be processed and organized in databases to provide access by astronomical community. ... Astronomy is the only science which has so many objects. ...

Еще в разделе: (Показать все результаты (>3298) - www.sai.msu.su/ )

• SAL- Computer Graphics, Images Signals - Misc - TINA
• SAL- Other Scientific Fields - Chemistry, Biology Related - Dynamite
• SAL- Computer Graphics, Images Signals - Processing Visualization - Pixies

THE POST-SIMPOSIUM EXCURSION ( July 31 - August 7,1998 ) . ... The six-day excursion took the participants from Lanzhou via the western loess hill country to the north-eastern Tibetan Plateau and via the West Quinling Mountains back to Lanzhou. ... This section is 39m thick and contains the loess of the last glacial period as well as a basal complex of flood loam. In the latter, three poorly developed Ah-horizons can be identified. ...

Еще в разделе: (Показать все результаты (>167) - www.fadr.msu.ru/ )

• SPECIAL ISSUE OF CATENA «RECONSTRUCTION AND CLIMATIC IMPLICATIONS OF PALEOSOLS»
• Abstracts

... First, calculate percentages of amino acids in every column + contribution = 1.0 / len ( self . sequences ) + all_columns = [] + for position in range( len ( self )): + column _percentage = {} + for seq in self.body : + if self.body [seq][position] is not None : + aa = self.body [seq][position].code + else: + aa = None + if aa in allpy.data.amino_acids: + if aa in column _percentage.keys(): + ...

Еще в разделе: (Показать все результаты (>31383) - kodomo.fbb.msu.ru/ )

• allpy: 59320c160dae
• allpy: 62e38970ffa2
• allpy: 0ef1a722b738 lib/project.py

... Bioinformatics Portal . GeneBee . ... Bioinformatics Portal of A.N.Belozersky Institute, . Moscow State University . Supported by the Russian Foundation for Basic Research, grant 13-07-00969-a . Original Services of GeneBee Group . Databanks screening . Sequence analysis . Screening by keywords . AliBee Multiple alignment Release 3.0 . AliGraf Graphical Alignment . AliComp Alignments Comparison . Screening by similarity Release 3.0 . ...

Еще в разделе: (Показать все результаты (>224) - www.genebee.msu.ru/ )

• Laboratory of protein-nucleic interactions (Russian version)
• GeneBee

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>38) - www.library.biophys.msu.ru/ )

SAI, graduates year 1982. ... Note: when just a 7-digit phone number is shown, it refers to a phone located in Moscow (international access 007-495). "+" in front of a number means that you must dial an international access code first (or just press "+" on your mobile phone keypad). ... 939-1672(work); . ... Ataev Sasha . 1-(703)-536-8881(home) (USA); . ... Bychkov Sergey . ... 1-(410)-740-8205(home), +1-(301)-286-2150(work) (USA); . ... 1-(412)-767-0332(home), +1-(412)-608-9339(mobile) (USA); . ...

Еще в разделе: (Показать все результаты (>19) - uranus.sai.msu.ru/ )

Laboratories \ Laboratory for The Sensory Systems of Vertebrates \ Goals and Tasks . Goals and Tasks . ... Electrophysiological Laboratory at the Utrish Marine Station . ... In the field of cetaceans hearing research: . ... Acuteness of the frequency selectivity (quality of the filters canals in the auditory system) in different species of dolphins constitutes the range of 30 to 50 that is 3-5 times higher than in most terrestrial mammals (excluding bats) and humans (about 10). ...

Еще в разделе: (Показать все результаты (>3803) - www.sevin.ru/ )

• Laboratories: Laboratory for Microevolution and Domestication of Mammals: Goals
• Laboratories: Group for Bioinformatics and Modeling Biological Process: Results
• Laboratories: Laboratory of Analytical Ecotoxicology: Results

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>31) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• Comparison of protein phylogeny reconstruction methods
• About

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>18) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us
• NPIDB: 5DPK structure

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Journals began from 'D' . Journal title [?] ... biology . ... Blackwell Publishing ] . ... Development . ... Developmental and Comparative Immunology . Elsevier Science ] . ... Developmental Biology . ... Developmental Biology BMC . ... Developmental Science . ... Doklady Biochemistry and Biophysics - Proceedings of the .. ... Doklady Biological Sciences . ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>201) - journals.genebee.msu.ru/ )

• JCatalog - Different journal alphabetic indexes