All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>108) - classic.chem.msu.su/ )

Network Working Group R. Nedved Request for Comments: 946 Carnegie-Mellon University May 1985 TELNET TERMINAL LOCATION NUMBER OPTION Status of this Memo This RFC proposes a new option for Telnet for the ARPA-Internet community, and requests discussion and suggestions for improvements. ... The 64-bit TTYLOC number has format 0. ... Description of the Option When the user Telnet connects to a remote host, it can attempt to send the terminal location number information by doing a IAC WILL TTYLOC command. ...

Еще в разделе: (Показать все результаты (>22514) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc946.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/internet-drafts/draft-boucadair-mptcp-max-subflow-01.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1110.txt.pdf

... The first options file is /etc/ppp/options, which is always scanned when pppd starts up. ... It allows each user to specify her own set of default options. A sample /etc/ppp/options file might look like this: # Global options for pppd running on vlager.vbrew.com auth # require authentication usehostname # use local hostname for CHAP lock # use UUCP-style device locking domain vbrew.com # our domain name The first two of these options apply to authentication and will be explained below. ...

Еще в разделе: (Показать все результаты (>650) - itpm.msu.su/ )

• Creating a user
• MySQL Reference Manual for version 3.23.10-alpha. - 19 Solving some common
• A Tour of Network Devices

To set a number of options place the set commands in the file .exrc . set ic set number set sh=/usr/local/bin/Tcsh set wm=5 . This sets vi to: . ignore the case of characters in searches . display line numbers . use the TC shell to execute UNIX commands . ... Options can also be set using the environment variable EXINIT. setenv EXINIT 'set ic number sh=/usr/local/bin/Tcsh wm=5' . For the C and TC shell user, this sets the same options as in the example above. ...

Еще в разделе: (Показать все результаты (>754) - comet.sai.msu.ru/ )

• Options that can be used to change the sort order
• Useful vi options
• Command options

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4827) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~igogo/Term3/pa_asp_t.txt
• http://kodomo.cmm.msu.ru/~pavel_s/term3/pa_result.txt
• Azor_Ecoli.entered

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>32291) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm_n.blast
• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt

A simple stack-based parser that parses infix expressions with nonary, unary and binary operators specified using an operator table. ... Creates a new infix parser. ... The tokeniser matches tokens in the following order: operators, quotes (" and '), numbers, words, brackets. ... name - operator string . ... The existance of close marks this as a bracket operator. casematters= - indicates that the parser should check case in the operator name (i.e. treat 'AND' and 'and' as different). ...

Еще в разделе: (Показать все результаты (>40995) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (1 vs. 2) - TWiki
• TWikiInfixParserDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... Instructions are in README.TXT file inside the tarball. ... tar -xvf nhunt_x86.tar Query and database files should contain sequences in FASTA format ( wikipedia description ). ... Default name of the output file is 'nhunt.out'. ... Any parameter consists of key and value and is called as '-key value', where 'key' is one character and 'value' is any number of characters. -i Query file . ... No default value. -d Database file . ... No default value. -o Output file . ... Default value: 'nhunt.out' . ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

Электронная библиотека Попечительского совета . ... Knott R. - Fibonacci Numbers and the Golden Section . ... Название: Fibonacci Numbers and the Golden Section . Автор: Knott R. Аннотация: . ... All involve the Fibonacci numbers - and here's how and why. The Golden section in NatureContinuing the theme of the first page but with specific reference to why the golden section appears in nature. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>13185) - lib.mexmat.ru/ )

• Lane S., Love S., Bowers B. - Using FileMaker 8 :: Электронная библиотека
• Sierpinski W. - Cardinal and ordinal numbers :: Электронная библиотека
• Cusick T.W. - Stream Ciphers and Number Theory :: Электронная библиотека

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4921) - cdfe.sinp.msu.ru/ )

• CDFE provides the major photonuclear databases. Online Services.

... This program was created for correlating chosen regions in the series of fts images. ... Chosen regions' . ... In this section the program counts the integral for each region of the grid for each image. ... As a matter of fact, the integral is total brightness of the region and it is counted by 'int_tabulated' IDL function. ... In addition, the program will show the count of the regions which correlate with the corresponding region (the brighter region means the bigger count) and its contour. ...

Еще в разделе: (Показать все результаты (>396) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR_EXPAND
• Rules for rough data file

... Number nine will put you on the spot. ... Naughty number nine. ... Is that it's one less than ten. You see, nine is the same as ten minus one. ... I mean, eight times nine is 80 minus eight, . And seven times nine is 70 minus seven, . And six times nine is 60 minus six. ... With naughty number nine. ... One times nine is nine, and two times nine is 18. Mean ol' number nine. ... Eight times nine is 72, and nine times nine is 81, . ... With naughty, nasty, mean ol' number nine. ...

Еще в разделе: (Показать все результаты (>6552) - crydee.sai.msu.ru/ )

• Three Is A Magic Number
• Descriptor index
• Tutorial on Fortran 90, Digital UNIX

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>25) - dbserv.sinp.msu.ru/ )

. In the current work the variability of the number of marginal flowers in inflorescences of 11 plant species from Compositae family depending on light and humidity level of the population and connection between the number of marginal flowers with other morphological characteristics of researched plants were studied. [full Russian text] . To the main page

Еще в разделе: (Показать все результаты (>357) - herba.msu.ru/ )

• Number of herbarium sheets of Dicotyledons in MW Herbarium
• Insect catching and carnivorous plants
• Материалы к полевому сезону

... Intermittency of vector fields and natural random number generators" . Kalinin A.O. and Sokoloff D.D. Growth of Jacobi fields on geodesic lines over a 2D manifold with Gaussian curvature as a random process is considered. ... Keywords: intermittency, vector field, Jacobi equation, random numbers, Lyapunov exponent. ... Kalinin A.O. тАУ Lomonosov Moscow State University, Faculty of Physics; Leninskie Gory, Moscow, 119991, Russia; Student, e-mail: kalinanton@me.com . ...

Еще в разделе: (Показать все результаты (>270) - num-meth.srcc.msu.ru/ )

• Composition of infinitary structures
• "Application of linear programming techniques to equilibrium composition
• "Efficiency evaluation of some compression methods for data transfer between

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

... wiki.web.ru . ... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Геология | ... 20.11.2001 | ... Сайт Number Theory Web , созданный и поддерживаемый К. Мэтьюзом, содержит очень много гиперссылок на ресурсы, относящиеся к теории чисел. Среди этих ресурсов домашние страницы (или, по крайней мере, адреса электронной почты) специалистов по теории чисел, курсы лекций, диссертации, книги, журналы, информация о конференциях, компьютерные программы и др. ...

Еще в разделе: (Показать все результаты (>411) - geo.web.ru/ )

NAME ab - Apache HTTP server benchmarking tool SYNOPSIS ab [ - k ] [ - i ] [ - n requests ] [ - t timelimit ] [ - c con- currency ] [ - p POST file ] [ - A Authenticate username : password ] [ - P Proxy Authenticate username : password ] [ - H Custom header ] [ - C Cookie name = value ] [ - T content - type ] [ - v verbosity ] [ - w output HTML ] [ - x table attributes ] [ - X proxy [:port] ] [ - y tr ... Default is no KeepAlive. - i Use an HTTP 'HEAD' instead of the GET method. ...

Еще в разделе: (Показать все результаты (>112) - neptun.sai.msu.ru/ )

• Running a High-Performance Web Server for BSD
• Manual Page: logresolve - Apache HTTP Server
• Apache Server Virtual Host Support

... Войти в систему . ... Другие названия журнала: J. Number Theory . ... Garaev M.Z. , Konyagin S.V. в журнале Journal of Number Theory , издательство Academic Press (United States) , том 145, с. 540-553 . ... Shkredov I.D. , Schoen T. в журнале Journal of Number Theory , издательство Academic Press (United States) , ? ... Moshchevitin N.G. в журнале Journal of Number Theory , издательство Academic Press (United States) , том 129, ? ...

Еще в разделе: (Показать все результаты (>1606) - istina.msu.ru/ )

• International Journal of Number Theory - журнал | ИСТИНА - Интеллектуальная

.

Еще в разделе: (Показать все результаты (>163) - nuclphys.sinp.msu.ru/ )