... MG1655, complete genome. (750 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006126 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 5.2 AE006218 Pasteurella multocida subsp. multocida str. ... Length = 12635 Score = 34.2 bits (17), Expect = 0.085 Identities = 20/21 (95%) Strand = Plus / Minus Query: 620 aagcgatcaaaatgctggcag 640 || ...

Еще в разделе: (Показать все результаты (>1350) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~agnetta/Term3/pm.txt
• http://kodomo.cmm.msu.ru/~aksinia/Term3/pa_tblastn
• http://kodomo.fbb.msu.ru/~alex2308/posled/homolog.txt

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4918) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>155) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Ringing analysis | Laboratory of Mathematical Methods of Image Processing
• Research | Laboratory of Mathematical Methods of Image Processing

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>233) - graphics.cs.msu.ru/ )

• Video processing | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>20) - ecoinformatica.srcc.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

This feature is only available with the Bourne Again Shell (bash). ... To complete a command name press the TAB key. tel <TAB> net telnet> . ... Pressing the TAB key again displays all the commands on your path that begin with those letters. For example: ma <TAB><TAB> mach mail makecookie man maze macptopbm make makedepend mapname . ... Command name completion also works in the middle of a command line. For example the command name teln <TAB> orion.geo.aber . ...

Еще в разделе: (Показать все результаты (>209) - comet.sai.msu.ru/ )

• Filename completion with the Korn shell
• Filename completion
• Filename completion with the C shell

MCQDPT vs. XMCQDPT: low-lying excited states of O3 molecule Ilya G. Ryabinkin1 , Laboratory of Quantum Mechanics and Molecular Structure, Chemistry Department of Moscow State University, 119991, Leninskie Gory 1-3, Moscow, Russia. ... XMCQDPT: low-lying excited states of O3 Introduction: A brief overview of MCQDPT theory Reliable, cost-effective alternative to other multi-reference (MR) approaches, such as MR-CI(+Q), ic -MRCI, MR-AQCC and MR-ACPF. ... XMCQDPT: low-lying excited states of O3 ...

Еще в разделе: (Показать все результаты (>64) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly Home Page
• Firefly DOCUMENTATION - command line arguments

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>712) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Ivan Sorokin
• Effective Syntheses of Group 4 Substituted Niobocenes

... Directives | ... Apache HTTP Server Version 2.0 . ... Directives in the configuration files may apply to the entire server, or they may be restricted to apply only to particular directories, files, hosts, or URLs. This document describes how to use configuration section containers or .htaccess files to change the scope of other configuration directives. ... Location> . ... Directives enclosed in a <Directory> section apply to the named filesystem directory and all subdirectories of that directory. ...

Еще в разделе: (Показать все результаты (>406) - itpm.msu.su/ )

• MySQL Reference Manual for version 3.23.10-alpha. - A Some MySQL users
• MySQL Reference Manual for version 3.23.10-alpha. - Concept Index
• MySQL Reference Manual for version 3.23.10-alpha. - 19 Solving some common

As it was already mentioned, the idea behind File Juggler is rather simple: using CGI scripts as processing tools and WWW browser as user interface, display the structure and content of typical anonymous FTP server in a convenient, easily navigated form. ... My P5-133 spends about 0.025 ms on one file when doing linear search with simple criterion (690 ms for 27,000 files, search for substring among file names/descriptions with 70 hits). ... Let's now look whether we can handle 1,000,000 files. ...

Еще в разделе: (Показать все результаты (>3250) - crydee.sai.msu.ru/ )

• Crydee.sai.msu.(ru,su) Archive
• Keyword arguments and default arguments
• Index of /ftproot/pub/comp/os/os2/leo/database

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Aloise S. , O?Keeffe P. , Cubaynes D. , Meyer M. , Grum-Grzhimailo A.N. в журнале Physical Review Letters , издательство American Physical Society (United States) , том 94, ? ... 2002 Strong, polarized Balmer-alpha fluorescence after resonant core excitation of HCl . ...

Еще в разделе: (Показать все результаты (>5685) - istina.msu.ru/ )

• Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy
• Laiho R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Physics Letters, Section A: General, Atomic and Solid State Physics - журнал |

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>143) - bioinf.fbb.msu.ru/ )

• SDPsite - Gallery of examples

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

Welcome to TWiki.. Users , Groups . ... Main ? ... AlexKopylov . ... TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... ChangePassword for changing your password . ChangeEmailAddress for changing your email address . TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . UserToolsCategory lists all TWiki user tools . ... Address: . ... Users . ... Copyright &© by the contributing authors. ...

Еще в разделе: (Показать все результаты (>36968) - dualopt1.cmm.msu.ru/ )

• ElenaZavyalova - Main - TWiki
• AndreyGolovin - Main - TWiki
• NewUserTemplate - TWiki - TWiki

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>52) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ososkov/ACATOsoskov.doc
• http://acat02.sinp.msu.ru/presentations/ivanchenko/iv.pdf
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf

. [ Войти ] . Главная -> Фильмы -> The Completely Mental Misadv.. Пользователи . Демо . Деньги . Фильмы . Форум . The Completely Mental Misadventures of Ed Grimley . США 1988 . отметить . Сериал . Мультфильм . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>321) - kinfo.ru/ )

• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• Complete Savages - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>61) - brain.bio.msu.ru/ )

• EEG Databases Links
• EEG Database - Schizophrenia
• Other prospects of the change-point based analysis