... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4819) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~pavel_s/term3/pa_result.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/result1.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/result3.txt

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>183) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Research | Laboratory of Mathematical Methods of Image Processing
• Ringing analysis | Laboratory of Mathematical Methods of Image Processing

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>22) - ecoinformatica.srcc.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

Modules | ... Apache HTTP Server Version 2.0 . ... Provides for user authentication using DBM files . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... Combining Group and Password DBM files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>362) - itpm.msu.su/ )

• The DNS Database
• The paths database
• Access control

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>98) - hist.msu.ru/ )

... Earth . Earth, and planetary tectonics . ... Earth, tectonic features of . ... Effective elastic thickness of a plate . ... Elastic deformation . Elastic deformation mechanisms . Elastic deformation, definition of . Elastic deformation, experimental fractures and . ... Elasticity . ... Elasticity, elastic behavior . ... En echelon . En echelon fractures . ... Extension . ... Extension fractures, fracture plane for . ... Extension fractures, vs. shear fractures . ... Extensional . ...

Еще в разделе: (Показать все результаты (>412) - geo.web.ru/ )

• Mineralogy Database - Все о Геологии (geo.web.ru)
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -
• Geochemical Rock Database - Все о Геологии (geo.web.ru)

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Image Database Retrieval by Fast Hermite Projection Method . ... http://graphics.cs.msu.ru/en/publications/text/gc2005kk.pdf . ...

Еще в разделе: (Показать все результаты (>200) - graphics.cs.msu.ru/ )

• Removal of comb effect from video | Лаборатория компьютерной графики и
• Removal of comb effect from video | Graphics and Media Lab
• Removing of blocking effect from video | Graphics and Media Lab

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4915) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE provides the major photonuclear databases. Online Services.
• Wave Function Value Database

. Laboratory for Neurophysiology and Neuro-Computer Interfaces . M.V.Lomonosov Moscow State University . Faculty of Biology . EEG Records Databases . EEG Databases available: . EEG of healthy adolescents and adolescents with symptoms of schizophrenia . Event-related potentials in a moving matrix modification of the P300 BCI . Other databases will be available soon.

Еще в разделе: (Показать все результаты (>59) - brain.bio.msu.ru/ )

• EEG Database - Schizophrenia
• Unsolved problems and new prospects
• Change-points at different levels of the hierarchy of EEG segmental...

. Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . Описание проблемы: . Введите почтовый адрес: . Войти в систему . Регистрация . Главная . Поиск . Статистика . О проекте . Помощь . Издательство: Springer-Verlag . Местоположение издательства: Heidelberg, Germany . ї 2011-2015 НИИ механики МГУ . Лаборатория 404. Все права защищены. обратная связь . Создать

Еще в разделе: (Показать все результаты (>5255) - istina.msu.ru/ )

• Distributed and Parallel Databases - журнал | ИСТИНА - Интеллектуальная Система
• International Journal of Intelligent Information and Database Systems - журнал
• Cochrane Database of Systematic Reviews - журнал | ИСТИНА - Интеллектуальная

Moscow State University, Geobotany dpt. English | ... Home Registration . ... password * . Minimal password length 4 symbols. Retype Password * . ... Science degree "without of science degree" "PhD" "D.Sc" . ... First Name * . Middle name . Last Name * . Name in english . ... Copyright 2012 Geobotany dpt. of MSU . ...

Еще в разделе: (Показать все результаты (>286) - herba.msu.ru/ )

• North Dakota Ethnobotany Database
• Heterogeneity in Northern Russian Alders
• Moscow State University, Geobotany dpt. - View Staff

... Algorithm & . Format requirements . Contact us . Gallery of examples . SDPsite was applied to 124 families fron the Pfam database . ...

Еще в разделе: (Показать все результаты (>144) - bioinf.fbb.msu.ru/ )

• Input Formats
• RNA Alignment
• RNA kinetics server

. G. I. Nikonov . Abstracts of the Xth International Conference on the Coordination and Organometallic Chemistry of Germanium, Tin and Lead, 8-12 July 2001, Bordeaux, France, OP13 . ABSTRACT . New effective methods for the syntheses of tin and germanium substituted niobocenes are reported. The results of X-ray studies are discussed. Laboratory of Coordination Organometallic Compounds

Еще в разделе: (Показать все результаты (>648) - chem.msu.ru/ )

• PC Crystal Chemistry Analysis of Organic Crystal Structures
• Length-of-stain indicator tubes for the determination of metals in waters and
• Moscow University Chemistry Bulletin Vol. 51, No. 6, P. 427 (2010)

. Parent Directory . 00-index . bullet25.zip . cslio205.zip . db02.zip . dbf2msql-2.0.zip . dbf2mysql-1.10d.zip . dbf_edit1_0.zip . dbffg04b.zip . dbfin096.zip . dbi-1_02.zip . dbv05.zip . mbase205.zip . msql-bench.zip . msql-mysql-modules-1_2010.zip . msql207b1.zip . mysql-c.zip . mysql-client-3.22.26a.zip . mysql2-3.22.26a.zip . odb.zip . os2mb106.zip . postgres652.zip . postgres7.0.0-server-bin_os2.zip . viper092.zip . www-mysql-0.5.7.zip . xdbfj19a.zip

Еще в разделе: (Показать все результаты (>2233) - crydee.sai.msu.ru/ )

• Work notes
• Visual effects