... Changed the way related types are stored for Alignment, Block, Sequence, Monomer Now each of them has attribute 'type', which is an object with four attributes: - Alignment - Block - Sequence - Monomer . ... allpy/base.py allpy/dna.py allpy/protein.py allpy/rna.py . ... allpy/base.py . ... allpy/dna.py . ... allpy/protein.py . ... allpy/rna.py . ... 1.59 - # Actually given value at EOF, since name Block is not yet defined 1.60 - 1.61 - sequence_type = Sequence 1.62 - """Type of sequences in...

Еще в разделе: (Показать все результаты (>113306) - kodomo.fbb.msu.ru/ )

• allpy: 78597d31d423
• allpy: 633a961e7586
• allpy: a400b16f8d4e

... Nucleotide sequences Protein sequences Protein structures Protein signatures Literature Protein seq's [SRS] . ... Summary Table . ... Ribose operon repressor. 326 . ... HTH-type transcriptional regulator regA. 332 . ... Ribose operon repressor. 329 . ... HTH-type transcriptional regulator galR (Galactose operon repressor). 342 . ... HTH-type transcriptional regulator galR (Galactose operon repressor). 343 . ... HTH-type transcriptional regulator malR (Maltose operon transcriptional repressor). 344 ....

Еще в разделе: (Показать все результаты (>9659) - kodomo.cmm.msu.ru/ )

• Changeset 13:5755534e5a8b тАУ Python Battle

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>7030) - monkey.belozersky.msu.ru/ )

Next: Subtyping Up: Untyped values Previous: Untyped values . ... 1: // IDL 2: struct foo { 3: long l; 4: short s; 5: }; 6: 7: // C++ 8: void operator<<= ( CORBA::Any &a, const foo &s ) 9: { 10: a.type( _tc_foo ); 11: a.struct_put_begin(); 12: a <<= s.l; 13: a <<= s.s; 14: a.struct_put_end(); 15: } 16: 17: CORBA::Boolean operator>>=( const CORBA::Any &a, foo &s ) 18: { 19: return a.struct_get_begin() && 20: (a >>= s.l) && 21: (a >>= s.s) && 22: a.struct_get_end(); 23: } . ...

Еще в разделе: (Показать все результаты (>657) - rtm-cs.sinp.msu.ru/ )

• Untyped values
• Subtyping
• Qt Toolkit - QListIterator Class

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>282) - www.genebee.msu.ru/ )

• AliGraf - GeneBee Graphical Alignment Help
• AliComp - GeneBee Alignment Comparison Help
• GeneBee BLAST 2.2.8 Services Help

... PHP 4 >= 4.1.0) import_request_variables -- Import GET/POST/Cookie variables into the global scope . bool import_request_variables ( string types [, string prefix]) . Imports GET/POST/Cookie variables into the global scope. ... Note: Although the prefix argument is optional, you will get a notice level error, if you specify no prefix, or specify an empty string as a prefix. ... This will import GET and POST vars // with an "rvar_" prefix import_request_variables("gP", "rvar_"); . ...

Еще в разделе: (Показать все результаты (>644) - oit.cmc.msu.ru/ )

• xml_parse_into_struct
• extract
• Variable Functions

... 7.1 Introduction to media types . ... 7.3 Recognized media types . 7.3.1 Media groups One of the most important features of style sheets is that they specify how a document is to be presented on different media: on the screen, on paper, with a speech synthesizer, with a braille device, etc. Certain CSS properties are only designed for certain media (e.g., the 'cue-before' property for aural user agents). ... For example, the 'font-size' property is useful both for screen and print media. ...

Еще в разделе: (Показать все результаты (>2726) - crydee.sai.msu.ru/ )

• Conformance: requirements and recommendations
• Heliophysics, Internal structure and seismology
• HTML 4.0 Frameset Document Type Definition

... Asperti A., Longo G. - Categories, types, and structures. Introduction to category theory for computer scientists . ... Название: Categories, types, and structures. ... Авторы: Asperti A., Longo G. Аннотация: . Category theory is a mathematical subject whose importance in several areas of computer science, most notably the semantics of programming languages and the design of programs using abstract data types, is widely acknowledged. ...

Еще в разделе: (Показать все результаты (>11878) - lib.mexmat.ru/ )

• Moldestad J. - Computations in Higher Types :: Электронная библиотека
• Verde-Star L. - Polynomial Sequences of Interpolator Type :: Электронная
• Jacobs K., Keane M. - 0-1-Sequences of Toeplitz Type :: Электронная библиотека

... Derived datatypes . Up: Point-to-Point Communication Next: Datatype constructors Previous: Null processes . ... Instead, MPI provides mechanisms to specify more general, mixed, and noncontiguous communication buffers. ... More general communication buffers are specified by replacing the basic datatypes that have been used so far with derived datatypes that are constructed from basic datatypes using the constructors described in this section. ... A sequence of basic datatypes . ... Центры . ...

Еще в разделе: (Показать все результаты (>590) - www.parallel.ru/ )

• MPI_Type_struct | PARALLEL.RU - Информационно-аналитический центр по
• Datatype Constructor MPI_TYPE_CREATE_INDEXED_BLOCK | PARALLEL.RU -
• Lower-bound and upper-bound markers | PARALLEL.RU - Информационно-аналитический

Next: SYSTEM CALL: msgget() Up: Internal and User Data Previous: Kernel msqid_ds structure . The kernel stores permission information for IPC objects in a structure of type ipc_perm . ... struct ipc_perm { key_t key; ushort uid; /* owner euid and egid */ ushort gid; ushort cuid; /* creator euid and egid */ ushort cgid; ushort mode; /* access modes see mode flags below */ ushort seq; /* slot usage sequence number */ }; . ... Finally, the slot usage sequence number is stored at the end. ...

Еще в разделе: (Показать все результаты (>381) - itpm.msu.su/ )

• Basic HTML data types
• Message buffer
• Converting Modules from Apache 1.3 to Apache 2.0 - Apache HTTP Server

RnaViz . RnaViz is a user-friendly, portable, windows-type program for producing publication-quality secondary structure drawings of RNA molecules. Drawings can be created starting from DCSE alignment files if they incorporate structure information or from mfold ct files. The layout of a structure can be changed easily. ... Home Site: . http://rrna.uia.ac.be/rnaviz/ . ... SAL Home | Other Scientific Fields | Chemistry, Biology Related . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>5026) - www.sai.msu.su/ )

• Type of Galaxies.
• SAL- Other Scientific Fields - Artificial Intelligence - ALE
• SAL- Other Scientific Fields - Chemistry, Biology Related - GEANFAMMER

... The numbers of three types of compact binaries containing accreting NSs and BHs, which are most interesting from the point of view of their observational appearances, have been calculated as a function of time: i) X-ray transient source containing a NS in an eccentric orbit around a main sequence Be-star (the observed prototype: A0535+26), ii) BH The evolution of the selected types of X-ray binaries during the first 10 million years after the starburst onset is presented in Fig. ...

Еще в разделе: (Показать все результаты (>442) - xray.sai.msu.ru/ )

• Roche lobe overflow (stage III)
• Mixing types of E-P-A binary systems with non-zero orbital eccentricity
• Post main sequence stars (stage II)

... Include form-based input in topics, with unlimited, user-selectable forms per web; values stored as Meta Data . Form-based input in topics, with name/value pairs stored as Meta Data variables; multiple forms per web & topic . ... Form Templates replace TWikiCategory Tables from the previous version of TWiki. ... On upgrading from the previous TWiki, a Form Template topic has to be built for each web that used a Category Table, recreating the fields and values from the old twikicatitems.tmpl . ...

Еще в разделе: (Показать все результаты (>38692) - dualopt1.cmm.msu.ru/ )

• TWikiMetaDotPm - TWiki - TWiki

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>22) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => NSR Search Engine

Modules | ... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 > Developer Documentation . ... The new structure is a great deal simpler... module MODULE_VAR_EXPORT module_name _module = { STANDARD20_MODULE_STUFF, /* create per-directory config structures */ /* merge per-directory config structures */ /* create per-server config structures */ /* merge per-server config structures */ /* command handlers */ /* handlers */ /* register hooks */ }; . ...

Еще в разделе: (Показать все результаты (>538) - uneex.lorien.cs.msu.su/ )

• Chapter?а5.?а Getting images into GIMP
• ERROR.TYPE
• Тип поля ввода

Research of residue contacts within the polypeptide chains depending on the density of information in the sequence S. D. Koshman Moscow Institute of Physics and Technology, koshman86@mail.ru A.A.Zinchenko Shemyakin-Ovchinnikov Institute RAS, alezina@mail.ru A.N. Nekrasov Shemyakin-Ovchinnikov Institute RAS, alexei_nekrasov@mail.ru INTRODUCTION. ... The developed program allows exploring the contacts between amino acid residues depending on their information types. ...

Еще в разделе: (Показать все результаты (>320) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/59.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/201.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/237.pdf

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>177) - www.enzyme.chem.msu.ru/ )

• Entrez-PubMed

T3SS protein . Protein's function . Clusters that contain protein . Alignment . ... translocon . ... chaperone . ... basal body* . 3 (277) . ... 110 (15) . ... export apparatus* . ...

Еще в разделе: (Показать все результаты (>12181) - mouse.belozersky.msu.ru/ )

• MTPro
• Example of alignment
• Geometrical core

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . ChangeLog . 2016-Jan-25 18:47:19 . 2.3K . application/octet-stream . ChangeLog-2015 . 2015-Nov-09 07:11:44 . 1.0K . application/octet-stream . Manifest . 2016-Jan-25 18:47:19 . 1.8K . application/octet-stream . importing-1.10.ebuild . 2015-Aug-09 03:38:18 . 0.5K . text/plain . metadata.xml . 2016-Jan-25 02:06:09 . 0.3K . text/xml . lighttpd/1.4.35

Еще в разделе: (Показать все результаты (>47742) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-python/ghp-import/
• Index of /pub/gentoo-portage/dev-ruby/compass-import-once/
• Index of /pub/gentoo-portage/dev-perl/Import-Into/

Encode character sequences in "string" , by mapping characters (or sequences of characters) to an alternative character (or sequence of characters). ... Parameter type not be used if old or new are given. old="tokenlist" . Comma-separated list of tokens to replace. ... new="tokenlist" . ... Example: %SEARCH{ "%ENCODE{ "string with "quotes"" type="quotes" }%" noheader="on" }% When using old and new , be aware that the results of applying earlier tokens are not processed again using later tokens. ...

Еще в разделе: (Показать все результаты (>5309) - wiki.cmc.msu.ru/ )