... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4627) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>590) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Ivan Sorokin
• Effective Syntheses of Group 4 Substituted Niobocenes

... About lab . ... Video processing . ... Video-based tracking . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Compression project . ... VQMT3D (Video Quality Measurement Tool 3D) project was created to improve stereoscopic films. ... Each frame of video sequence is subdivided into regions of two types: foreground and background objects. ... High-quality increase of video color depth . ... Keyframe-based Depth Compression with Depth Propagation for Multiview Video Coding . ...

Еще в разделе: (Показать все результаты (>192) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>118) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>29222) - kodomo.fbb.msu.ru/ )

• allpy: 62e38970ffa2 lib/sequence.py
• allpy: 56bea23d3c73 lib/block.py
• allpy: 08494fb2c47a lib/block.py

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>143) - bioinf.fbb.msu.ru/ )

MCQDPT vs. XMCQDPT: low-lying excited states of O3 molecule Ilya G. Ryabinkin1 , Laboratory of Quantum Mechanics and Molecular Structure, Chemistry Department of Moscow State University, 119991, Leninskie Gory 1-3, Moscow, Russia. ... XMCQDPT: low-lying excited states of O3 Introduction: A brief overview of MCQDPT theory Reliable, cost-effective alternative to other multi-reference (MR) approaches, such as MR-CI(+Q), ic -MRCI, MR-AQCC and MR-ACPF. ... XMCQDPT: low-lying excited states of O3 ...

Еще в разделе: (Показать все результаты (>61) - classic.chem.msu.su/ )

• Firefly DOCUMENTATION - command line arguments

. [ Войти ] . Главная -> Фильмы -> The Completely Mental Misadv.. Пользователи . Демо . Деньги . Фильмы . Форум . The Completely Mental Misadventures of Ed Grimley . США 1988 . отметить . Сериал . Мультфильм . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>206) - kinfo.ru/ )

• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• Complete Savages - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>55) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>3599) - istina.msu.ru/ )

• Virus Genes - журнал | ИСТИНА - Интеллектуальная Система Тематического
• James D. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Kotlyarov R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... WolfDoom for help on ambient effects and some sounds. ... You must have my permission to put on CD * Where to get this WAD * FTP sites: ftp.cdrom.com Other: Me -Build history- v0.1 *ALPHA* 12-15-1997 Released to a few friends online Basic wad functions ( music , gfx, snd) v0.2 * beta 1* DATE UKNOWN (lost track) weapons added Added dehacked patch for special effects added 2 enemies Messed up on DEH, rewrote it over. :( v0.25 * beta 2* DATE UKNOWN Ambience added ! more graphics ...

Еще в разделе: (Показать все результаты (>2419) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/wd/mirror/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/d-f/debut_ep.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/d-f/dakills.txt

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>21) - cdfe.sinp.msu.ru/ )

... Effect of disulfide crosslinking on thermal transitions and chaperone-like activity of human small heat shock protein HspB1. ... Temperature-induced conformational changes of reduced and oxidized HspB1 crosslinked by disulfide bond between single Cys137 of neighboring monomers were analyzed by means of different techniques. ... Oxidation resulted in decrease of chaperone-like activity of HspB1. ...

Еще в разделе: (Показать все результаты (>97) - biochem.bio.msu.ru/ )

• Inhibitory effect of palmitate on the mitochondrial NADH:ubiquinone
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

... Effects of Pulsed Focused Ultrasound at Pressures Beyond the Cavitation Threshold: Histological Study on Rabbit Brain in Vivo . ... Objective: To study histological effects of high intensity short-pulsed focused ultrasound on mammalian tissues. ... MR-imaging was used to aim the beam, monitor the exposure, and evaluate the effects. ... Conclusion: High intensity focused ultrasound can cause tissue damage by destroying brain tissue due only to the mechanical impact of ultrasound beam. ...

Еще в разделе: (Показать все результаты (>274) - acs366.phys.msu.su/ )

• Abstract (Invited)

Back to homepage >> . ... key words: [ melt inclusions, experiment, diffusion, boundary layer effect ] . ... In order to distinguish an influence of the boundary effects on the composition of melt inclusions, the experiment on growth of alkali feldspar (Fsp) crystal in the haplogranitic system (Q-Ab-Or) was performed. ... Estimation of an influence of the boundary effect on melt inclusion composition . ... The larger inclusion the weaker its influence on the boundary layer. ...

Еще в разделе: (Показать все результаты (>317) - geo.web.ru/ )

• The influence of boundary layer effects on the melt inclusions compositions.
• Dictionary_E

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>19) - angel.cs.msu.su/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>129) - hist.msu.ru/ )

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>131) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>25) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/guidetomarketresearch.doc
• http://www.innovation.msu.ru/english/reportofinvention.doc

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>269) - itpm.msu.su/ )

• Apache Tutorial: .htaccess files - Apache HTTP Server
• Formatting
• Dialing out with chat