markx0 # Report_file: ahpf_ecoli.matcher ######################################## #======================================= # # Aligned_sequences : 2 # 1: AHPF_ECOLI # 2: TRXB_BACSU # Matrix: EBLOSUM62 # Gap_penalty : 14 # Extend_penalty : 4 # # Length : 310 # Identity : 101/310 (32.6%) # Similarity: 170/310 (54.8%) # Gaps : 6/310 ( 1.9%) # Score: 455 # # #======================================= 210 220 230 240 250 ...

Еще в разделе: (Показать все результаты (>4258) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~ksenia_yashina/projects/aln/suboptimal.matcher
• http://kodomo.cmm.msu.ru/~seferyan_m/projects/emboss/risa_ecoli_risa_myctu.matcher
• http://kodomo.fbb.msu.ru/~alex2308/viravnivanie/match.matcher

Program: matcher # Rundate: Tue Apr 04 2006 13:14:21 # Align_format: markx0 # Report_file: 1to3.matcher ######################################## #======================================= # # Aligned_sequences: 2 # 1: # 2: # Matrix: EBLOSUM62 # Gap_penalty: 14 # Extend_penalty: 4 # # Length: 16 # Identity: 13/16 (81.2%) # Similarity: 14/16 (87.5%) # Gaps: 0/16 ( 0.0%) # Score: 64 # # #======================================= 130 SYSFVAMAKACRSMLN .: ...

Еще в разделе: (Показать все результаты (>11113) - kodomo.fbb.msu.ru/ )

• allpy: 20636c0df58c allpy/pdb.py
• allpy: lib/sequence.py diff
• allpy: 675b402094be lib/sequence.py

... Type matching rules . Up: Data type matching and data conversion Next: Type MPI_CHARACTER Previous: Data type matching and data conversion . ... Message data . ... Communication of typed values (e.g., with datatype different from MPI_BYTE), where the datatypes of the corresponding entries in the sender program, in the send call, in the receive call and in the receiver program must all match. ... Up: Type matching rules Next: Data conversion Previous: Type matching rules . ... Центры . ...

Еще в разделе: (Показать все результаты (>263) - www.parallel.ru/ )

• Blocking receive | PARALLEL.RU - Информационно-аналитический центр по
• Type Matching | PARALLEL.RU - Информационно-аналитический центр по параллельным

Network Working Group Request for Comments: 5292 Category: Standards Track E. Chen S. Sangli Cisco Systems August 2008 Address-Prefix-Based Outbound Route Filter for BGP-4 Status of This Memo This document specifies an Internet standards track protocol for the Internet community, and requests discussion and suggestions for improvements. ... Conceptually, an Address Prefix ORF entry consists of the fields <Sequence, Match, Length, Prefix, Minlen, Maxlen>. ... NLRI.length == ORF.length | ...

Еще в разделе: (Показать все результаты (>13619) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5292.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/bcp/bcp198.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc7608.txt.pdf

Электронная библиотека Попечительского совета . ... Percus J.K. - Mathematics of genome analysis . ... Название: Mathematics of genome analysis . Автор: Percus J.K. Аннотация: . ... This short textbook presents a brief description of several ways in which mathematics and statistics are being used in genome analysis and sequencing. ... Subsequence analysis, categories 108 . Subsequence analysis, clusters 109 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>6480) - lib.mexmat.ru/ )

• Wright W.H. - Some Probable Identities in Wave-Length in Nebular and Stellar
• Поиск книг, содержащих correlation length :: Электронная библиотека
• Поиск книг, содержащих Extrapolation length :: Электронная библиотека

... The approach for estimation of the homology search program sensitivity in nucleotide case was proposed in paper I.Anderson, A.Brass , "Searching DNA databases for similarities to DNA sequences: when is a match significant?" ... Seven sequences were chosen to have length varying from 100 to 1000 bp. ... Each of the 1000 artificially evolved sequences was used as a query for database search with Genebee search, blast-2.0.8 and fasta-3.3 as search engine. ... Sequence length . ... 100 . ... Blast 2.0 ....

Еще в разделе: (Показать все результаты (>133) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• NCBI BLAST Advanced Options

... SELECT file, title, rank(ts_vec, to_tsquery('create schema')) FROM postgresql_manual WHERE ts_vec @@ to_tsquery('create schema') ORDER BY rank(ts_vec, to_tsquery('create schema')) DESC LIMIT 5; file | title | ... CREATE SCHEMA | ... SELECT file, title, rank('{0, 0, 0.01, 0.99}',ts_vec_tb, to_tsquery('create aggregate')) FROM postgresql_manual WHERE ts_vec_tb @@ to_tsquery('create aggregate') ORDER BY rank('{0, 0, 0.01, 0.99}', ts_vec_tb, to_tsquery('create aggregate')) DESC LIMIT 5; file | ...

Еще в разделе: (Показать все результаты (>761) - www.sai.msu.su/ )

• Zen: ReadmeTrgm
• APOD: 2001 April 1 - Americans Defeat Russians in First Space Quidditch Match
• APOD: 2007 April 1- Americans Defeat Russians in First Space Quidditch Match

PHP Manual . Prev . Next . 3.0.3 - 3.0.18 only, PHP 4 >= 4.0.0) strspn -- Find length of initial segment matching mask . int strspn ( string str1, string str2) . Returns the length of the initial segment of str1 which consists entirely of characters in str2 . ... var = strspn("42 is the answer, what is the question ...", "1234567890"); . will assign 2 to $var , because the string "42" will be the longest segment containing characters from "1234567890". ...

Еще в разделе: (Показать все результаты (>305) - oit.cmc.msu.ru/ )

• strcspn
• preg_match_all
• preg_match

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>30) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-3.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out

The QRegExp class provides pattern matching using regular expressions and wildcards. ... QRegExp  ( const char *, bool caseSensitive=TRUE, bool wildcard=FALSE )  . ... QRegExp&  operator=  ( const char * pattern )  . bool  operator==  ( const QRegExp & ) const . ... bool  wildcard  () const . ... QRegExp knows these regexp primitives: . ... Returns TRUE if this regexp is equal to r. Two regexp objects are equal if they have equal pattern strings, case sensitivity options and wildcard options. ...

Еще в разделе: (Показать все результаты (>262) - rtm-cs.sinp.msu.ru/ )

• Qt Font Matching
• Qt Toolkit - QImageDecoder Class
• Qt Toolkit - QImageFormat Class

Next: SYSTEM CALL: msgctl() Up: 6.4.2 Message Queues Previous: SYSTEM CALL: msgget() . ... To deliver a message to a queue, you use the msgsnd system call: . ... The first argument to msgsnd is our queue identifier, returned by a previous call to msgget . ... The msgsz argument contains the size of the message in bytes, excluding the length of the message type (4 byte long). ... The fourth argument ( mtype ) specifies the type of message to retrieve from the queue. ...

Еще в разделе: (Показать все результаты (>182) - itpm.msu.su/ )

• Mixing and Matching Binary Distributions
• mod_negotiation - Apache HTTP Server
• Sample smail Configuration Files

. Album : asv-album :: Travels to distant places and countries :: 1997/08 Kyoto, Nara (Japan) :: 23/08 Ryoanji Temple and around . Up . << Prev . A bug which produces loud high-pitched noise. The actual length is about 5-6 cm. Next >> . Created with the tool album generator a MarginalHack by David on Tue Jun 23 14:46:19 2015 .

Еще в разделе: (Показать все результаты (>1528) - crydee.sai.msu.ru/ )

• Mixing Length Theory
• Index
• Not so well documented Device Helpers in OS/2

. You can use the following metacharacters within any shell to create regular expressions that match file names. ? matches any single character * matches any number of any characters [nnn] matches any of the enclosed characters [!nnn] matches any character that is not enclosed [n-n] matches any character in this range . Examples .

Еще в разделе: (Показать все результаты (>99) - comet.sai.msu.ru/ )

• Defining files with wildcard characters
• Using regular expressions with the grep command

... Source File: mod_negotiation.c . Module Identifier: negotiation_module Content negotiation, or more accurately content selection, is the selection of the document that best matches the clients capabilities, from one of several available documents. ... A type map (a file with the handler type-map ) which explicitly lists the files containing the variants. ... Apache only recognizes encodings that are defined by an AddEncoding directive. ... Content-Language: . ... Module: mod_negotiation . ...

Еще в разделе: (Показать все результаты (>60) - neptun.sai.msu.ru/ )

• Apache module mod_setenvif

... Prev . Next . ... MATCH(seek,vector[,type]) . MATCH function finds the row index of @seek in @vector and returns it. If the area is longer than it is wide then the sense of the search is rotated. ... If @type = 1, finds largest value <= @seek. If @type = 0, finds first value == @seek. If @type = -1, finds smallest value >= @seek. For type 0, the data can be in any order. ... And in this case, MATCH uses a binary search to locate the index.) ...

Еще в разделе: (Показать все результаты (>238) - uneex.lorien.cs.msu.su/ )

• mod_negotiation - Apache HTTP Server
• Справочник по CSS
• mod_deflate - Apache HTTP Server

... = = # query sequence file: /data/npidb/pdb/pdb_new/fasta/3m85.pdb1.pdb.fas # searching against: /mnt/databanks/pfamdata/Pfam-A. hmm , with cut off -E 0.001 --domE 0.001 # resolve clan overlaps: on # predict active sites: off # = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = # # seq id alignment start alignment end envelope start envelope end hmm acc hmm name type ...

Еще в разделе: (Показать все результаты (>6950) - mouse.belozersky.msu.ru/ )

• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/hmm/3wpc.pdb1.pdb.hmm.txt
• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/hmm/3mvd.pdb1.pdb.hmm.txt
• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/hmm/3m7n.pdb1.pdb.hmm.txt

... Звезды: их строение, жизнь и смерть . ... Публикации с ключевыми словами: Сверхновые - звезды - сверхгигант - нейтронные звезды - красный гигант - бурый карлик - диаграмма Герцшпрунга-Рессела - белый карлик - Эволюция звезд - термоядерные реакции - вырожденный газ - гидростатическое равновесие - конвекция - лучистый перенос - главная последовательность - эволюционный трек звезды - карлики . ... Звезды . ... Все публикации на ту же тему >> . Обсудить эту публикацию . ...

Еще в разделе: (Показать все результаты (>1105) - www.astronet.ru/ )

• Americans Defeat Russians in First Space Quidditch Match
• APOD: 2007 April 1- Americans Defeat Russians in First Space Quidditch Match
• Астронет > Americans Defeat Russians in First Space Quidditch Match

... About lab . ... Robust Matching of Aerial Images with Low Overlap . ... Aerial Triangulation , Image Matching , Image Registration , Low Overlap . ... This paper addresses the problem of aerial image matching. We analyze existing approaches to this problem and show that, though the modern algorithms cope with the task quite well, their results are deteriorated in case of low overlap and significant rotation angle between the images. A two-stage feature-based image matching scheme is presented. ...

Еще в разделе: (Показать все результаты (>74) - graphics.cs.msu.ru/ )

• GML Aero Matching | Graphics and Media Lab
• Infrared marker matching for object tracking in stereo setup | Graphics and
• Automatic Matching of Terrestrial Scan Data Using Orientation Histograms |

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Издательство: University of Kragujevac . ... Tratch S.S. , Molchanova M.S. , Zefirov N.S. в журнале Match , издательство University of Kragujevac (Serbia) , том 61, ? ... Kerber А. , Tratch S. в журнале Match , издательство University of Kragujevac (Serbia) , том 61, ? ... 2003 Match: Editorial . ...

Еще в разделе: (Показать все результаты (>771) - istina.msu.ru/ )

• Kerber A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Class . ... FIELD | ... java.lang.Object | ucar.netcdf.Dimension . ... public class Dimension . ... A Dimension object is used to contain an array length which is named for use in multiple netcdf variables. This class supports construction, retrieval of the name and retrieval of the length value. ... protected int . ... Dimension (java.lang.String name, int length) . ... Constructor Detail public Dimension (java.lang.String name, int length) . ... length - int length of this Dimension . ...

Еще в разделе: (Показать все результаты (>36) - angel.cs.msu.su/ )

• : Class UnlimitedDimension
• Serialized Form
• : Class DecimateMap