Query: 1 atgactaaacactatgattacatcgccatcggcggcggcagcggcggtatcgcctccatc 60<br> ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| || <br> Sbjct: 2544 atgaccaaacactatgattacatcgctatcggcggcggcagcggcggtatcgcctcgatt 2603 <br> Query: 61 aaccgcgcggctatgtacggccagaaatgtgcgctgattgaagccaaagagctgggcggc 120 || ... Sbjct: 3504 ctctccgagcgcctgtttaacaacaagccggaagagcatctggactacagcaacatcccg 3563 Query: 1021 accgtggtcttcagccatccgccgattggtactgttggtttaacggaaccgcaggcgcgc 1080 || ...

Еще в разделе: (Показать все результаты (>1433) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~gmarusja/3_1/alignment.txt
• http://kodomo.cmm.msu.ru/~bennigsen/term3/prac8/bestalign.txt
• http://kodomo.cmm.msu.ru/~mamichev-ivan/Term_3/Blast/aligment.txt

. Search the Web Usenet and Display the Results in Standard Form in Compact Form in Detailed Form as a Count only . Use only Advanced Query Syntax with AND , OR , NOT and NEAR . Simple Query Syntax will not work! . Results Ranking Criteria: documents containing these words will be listed first. If left blank, the matching documents will not be sorted. Start date: End date: e.g. 21/Mar/96 .

Еще в разделе: (Показать все результаты (>17) - comet.sai.msu.ru/ )

• Query replace

... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Owner Type Status Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>5) - kodomo.cmm.msu.su/ )

• Custom Query в?' Cyclyc Cell Automata

... Extract new values for form fields from a query. $query - the query . metaObject - the meta object that is storing the form values . ... initialiseMissing - if true, will cause fields that are in the form but have no value in the query or in the meta to be initialised to ''. ... Returns the number of fields which had values provided by the query, and a references to an array of the names of mandatory fields that were missing from the query. ... new ClassMethod new ($session,$web,$form) . ...

Еще в разделе: (Показать все результаты (>27099) - dualopt1.cmm.msu.ru/ )

• TWikiQueryNodeDotPm - TWiki - TWiki
• TWikiQueryHoistREsDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... Поиск гомологов пакетом BLAST . ... Информация о геноме - в моем случае о полном геноме возбудителя черной гнили капусты Xanthomonas campestris - была дана в виде аннотированной нуклеотидной последовательности в файле xc_genome.fasta . ... Характеристики лучшей находки в геноме Xanthomonas campestris : . ... Sbjct: 2199 gtgagcatgtctgaacagcaaatagactgggatctggccctgatccagaaatataactat 2258 Query: 61 tccgggccacgatacacctcgtacccgaccgcgctggagttttcagaagacttcggcgaa 120 || ... designed by Alex Makarov ...

Еще в разделе: (Показать все результаты (>3251) - kodomo.fbb.msu.ru/ )

• Test for credit 2
• Элементарные эволюционные события
• Test work (BLASTP)

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>253) - istina.msu.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>185) - cdfe.sinp.msu.ru/ )

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>4) - depni.sinp.msu.ru/ )

BIRD SPECIES DATABASE . of the Arctic Birds Breeding Conditions Survey . ... Queries . View list of species . ... Get list of species, for which data are available by pushing "Query" button below "View list of species" invitation. Latin name of a species can be copied from the list to the "Species name" field or typed-in there (but exactly as it appears in the species list). ... Query results will be tabulated in the window below the map, and can be browsed through or copied. ...

10. Verifying the Name Server Setup

11. Live Nude Girls Unite! - Фильмы - Kinfo.ru

12. RNA kinetics server

13. List of WWW-SEARCH ENGINE and other info site

14. GeForce GTX 280 configuration and driver details

15. http://journals.genebee.msu.ru/include/jinfo.inc.php?j_id=1817&back=/j_output.php$type=all

16. http://herba.msu.ru/shipunov/os/google/google.pdf

17. http://genphys.phys.msu.su/mikromag/script/authuser.php3

18. cheap moncler uk 4 16v loss of oil pressure at 2000rpm | С Днем Победы!

19. Search

20. http://acat02.sinp.msu.ru/presentations/GGtut/Dev-08-Information1.pdf