Электронная библиотека Попечительского совета . ... Boerner H. - Representations of Groups . ... Название: Representations of Groups . ... Adjoint representation of the rotation group 234 . ... Alternating group, representations 197 . ... Characteristic of rational integral representation of full linear group 185 . ... Complex orthogonal group, fundamental representations 264 . ... Representation of group ring 54 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>15664) - lib.mexmat.ru/ )

• Siddons S. - The Complete Presentation Skills Handbook: How to Understand and
• Smullyan R.M. - Recursion Theory for Metamathematics :: Электронная библиотека
• Kirillov A.A. - Elements of the Theory of Representations :: Электронная

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>235) - comet.sai.msu.ru/ )

• Filename completion with the Bourne Again SHell
• Filename completion with the TC shell
• Filename completion with the C shell

GRASP . ... The editor provides complete syntax coloring with user selected colors and fonts. GRASP provides complete support for generating, editing, and printing Control Structure Diagrams (CSDs) from Ada 95, C, Java, and VHDL source code. The CSD is a diagram intended to increase the comprehension efficiency of source code. ... Home Site: . http://www.eng.auburn.edu/grasp . Source Code Availability: No . ... User Comments: . ... SAL Home | Programming | Tools & Utilities . ...

Еще в разделе: (Показать все результаты (>2879) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS - Recital
• FTS Complete Tutorial
• SAL- Numerical Analysis - Discrete Methods Related Tools

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>942) - chem.msu.ru/ )

• Systematical Search for New Types of Chemical Interconversions: Mathematical

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4073) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>118) - sp.cs.msu.ru/ )

Each row in the Particles Table describes a particle - anti-particle pair. ... 2*Spin for a doubled particle spin: 0 for scalar, 1 for spinor and 2 for vector particles. ... In this case the anti-particle "A+" is transformed by conjugated representation. ... Aux for an auxiliary field which allows to modify particle propagators. ... spin 0 case: . ... Zero mass vector particle must be marked as a gauge one using the Aux field (see below). ... is permitted for vector ( 2*spin=2 ) particle. ...

Еще в разделе: (Показать все результаты (>2380) - theory.sinp.msu.ru/ )

• [Comphep-common] Re: $COMPHEP/genEvents
• [Comphep-common] Events to produce of LHAEF format
• Menu 5.

-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash-completion-r1 git -2 elisp-common DESCRIPTION= Stores, retrieves, generates, and synchronizes passwords securely using gpg, pwgen, and git HOMEPAGE= http://www.passwordstore.org/ EGIT_REPO_URI= http:// git .zx2c4.com/password-store SLOT= 0 LICENSE= GPL-2 KEYWORDS= IUSE= + ...

Еще в разделе: (Показать все результаты (>19322) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-admin/pass/pass-1.6.5.ebuild
• Index of /pub/gentoo-portage/app-shells/bash-completion/files/

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>12970) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 1e5116ce9d75 .hgignore

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Progress . ... RMA calls must have local semantics, except when required for synchronization with other RMA calls. ... On the origin process, an RMA communication may become enabled as soon as the corresponding put, get or accumulate call has executed, or as late as when the ensuing synchronization call is issued. ... This code will deadlock: the wait of process 1 blocks until process 0 calls complete, and the receive of process 0 blocks until process 1 calls send. ... Центры . ...

Еще в разделе: (Показать все результаты (>696) - www.parallel.ru/ )

• Clarification of MPI_FINALIZE | PARALLEL.RU - Информационно-аналитический центр
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Opaque Objects | PARALLEL.RU - Информационно-аналитический центр по

A problem, that can arise when moving from Fortran 77 to Fortran 90, is dependent on a usual deviation from the standard, and has to do especially with user programs. ... With many Fortran 77 implementations we wrote PROGRAM TEST REAL X WRITE(*,10) 10 FORMAT('Give X = ',$) READ(*,*) X WRITE(*,*) X END In Fortran 90 we use "non-advancing I/O" instead. ... In some old Fortran dialects the statement TYPE was used to write on a typewriter terminal and PRINT was used to write on the line printer. ...

Еще в разделе: (Показать все результаты (>15935) - crydee.sai.msu.ru/ )

• Historical Notes
• Image: After my presentation, on the KICH verandah. I am satisfied.
• Generic routines

... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Generate More Sales With One Of These SEO . ... Search engines like yahoo will most likely view such sites as you possibly can spam, and may also ban your blog off their listings altogether. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>4266) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Generate More Sales By Using
• Экологический Форум - Фундаментальная Экология: that will generate a peril on
• Экологический Форум - Фундаментальная Экология: i just completed a whole

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:27 Sat , 04 Dec 2010 20:32:41 GMT darkhan [21:bb4a79cc6b6e] I don't understand... default mercurial: created new head, merged branch Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( modified ) Completed Automata: change_size, import from State, default states Sat , 04 Dec 2010 19:51:23 GMT Ilia [19:3d1a72f49417] * ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=749533cdfc67782471aea02a0e4a1859de8ef2bd&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=22%3A749533cdfc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=c74a9885bf048a4938c290470e671c1c9c68dd33&limit=100&mode=stop_on_copy

Modules | ... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 . ... Core Features and Multi-Processing Modules . Other Modules . ... Multi-Processing Module implementing an exclusively threaded web server optimized for Novell NetWare . ... Multi-Processing Module allowing for daemon processes serving requests to be assigned a variety of different userids . ... This module provides for executing CGI scripts based on media type or request method. mod_alias . ...

Еще в разделе: (Показать все результаты (>421) - uneex.lorien.cs.msu.su/ )

• Getting Ready to Sign
• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX
• mod_charset_lite - Apache HTTP Server

Modules | ... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 . ... Core Features and Multi-Processing Modules . Other Modules . ... Multi-Processing Module implementing an exclusively threaded web server optimized for Novell NetWare . ... Multi-Processing Module allowing for daemon processes serving requests to be assigned a variety of different userids . ... This module provides for executing CGI scripts based on media type or request method. mod_alias . ...

Еще в разделе: (Показать все результаты (>373) - itpm.msu.su/ )

• What is a Mail Message?
• Mixing UUCP and RFC-822
• Getting smail Up and Running

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>96) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>169) - nuclphys.sinp.msu.ru/ )

... Changed: . ... text/html . ... Returns the URL to a TWiki script, providing the web and topic as "path info" parameters. ... Input: Return: ( 'Web', 'Topic' ) ( 'Web', 'Topic' ) ( '', 'Topic' ) ( 'Main', 'Topic' ) ( '', '' ) ( 'Main', 'WebHome' ) ( '', 'Web/Topic' ) ( 'Web', 'Topic' ) ( '', 'Web.Topic' ) ( 'Web', 'Topic' ) ( 'Web1', 'Web2.Topic' ) ( 'Web2', 'Topic' ) ( 'Main', 'Web2.Topic' ) ( 'Main', 'Topic' ) ( 'TWiki', 'Web2.Topic' ) ( 'TWiki', 'Topic' ) Note: Function renamed from getWebTopic . ...

Еще в разделе: (Показать все результаты (>38150) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (13 vs. 14) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki
• TWikiUIViewDotPm - TWiki - TWiki

This module is contained in the mod_dir.c file, and is compiled in by default. It provides for "trailing slash" redirects and serving directory index files. ... A file written by the user, typically called index.html . The DirectoryIndex directive sets the name of this file. This is controlled by mod_dir . ... Example: DirectoryIndex index.html then a request for http://myserver/docs/ would return http://myserver/docs/index.html if it exists, or would list the directory if it did not. ...

Еще в разделе: (Показать все результаты (>760) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QNPStream Class
• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream member list