Электронная библиотека Попечительского совета . ... Lewis H.G. - Effective E-Mail. The Complete Guide to Creating Successful Campaigns . ... Название: Effective E-Mail. ... Автор: Lewis H.G. Аннотация: . E-mail is the first force-communication phenomenon of the twentyfirst century. ... In fact, e-mail is an easier form of communication than speech, because the e-mail sender can catch and repair errors that readily slip out between the lips.) ...

Еще в разделе: (Показать все результаты (>112953) - lib.mexmat.ru/ )

• Rosen A. - Effective IT Project Management: Using Teams to Get Projects
• Green R., Allen L. - Expert CAD Management: The Complete Guide :: Электронная
• Smullyan R.M. - Recursion Theory for Metamathematics :: Электронная библиотека

MCQDPT vs. XMCQDPT: low-lying excited states of O3 molecule Ilya G. Ryabinkin1 , Laboratory of Quantum Mechanics and Molecular Structure, Chemistry Department of Moscow State University, 119991, Leninskie Gory 1-3, Moscow, Russia. ... XMCQDPT: low-lying excited states of O3 Introduction: A brief overview of MCQDPT theory Reliable, cost-effective alternative to other multi-reference (MR) approaches, such as MR-CI(+Q), ic -MRCI, MR-AQCC and MR-ACPF. ... XMCQDPT: low-lying excited states of O3 ...

Еще в разделе: (Показать все результаты (>67) - classic.chem.msu.su/ )

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2009) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/megablastdis.out

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>204) - graphics.cs.msu.ru/ )

• Video processing | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и

. PHP Manual . Prev . Next . (PHP 4 >= 4.0.0) readline_completion_function -- Registers a completion function . bool readline_completion_function ( string line) . This function registers a completion function. You must supply the name of an existing function which accepts a partial command line and returns an array of possible matches. This is the same kind of functionality you'd get if you hit your tab key while using Bash. Prev . Home . Next . readline_clear_history . Up . readline_info

Еще в разделе: (Показать все результаты (>330) - oit.cmc.msu.ru/ )

• ncurses_clear
• readline_clear_history
• Parser behavior

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>9973) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: log

The problem of turbulence is one of the most important and challenging problem of the modern science. ... An experimental investigation of turbulent flows with special experimental setup and equipment, which allow to obtain reliable data with good precision, is very difficult and expensive process. ... The natural assumption for the theory of turbulence is that there exist some (unknown yet) general and universal properties for wide range of different turbulent flows. ...

Еще в разделе: (Показать все результаты (>2852) - www.sai.msu.su/ )

• FTS Complete Tutorial
• SAL- Programming - Languages Compilers - NetRexx
• The power of Bump Map

... A Solar Eclipse Painting from the 1700s . ... 28.01.2008 . ... Credit: Jay Pasachoff Explanation: Is this painting the earliest realistic depiction of a total eclipse of the Sun? ... Roberta J. M. Olson and Jay Pasachoff have hypothesized that Asam himself may have seen first hand one or all of the total solar eclipses of May 1706, 1724, and 1733. ... Publications with keywords: total solar eclipse . Publications with words: total solar eclipse . ... A Total Solar Eclipse over Turkey . ...

Еще в разделе: (Показать все результаты (>10278) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• A Complete Solar Cycle from SOHO
• A Complete Aurora

... Another strong point of this model is that the participants can reach not only intellectual understanding but also an affective tolerance of cultural differences in the process of intercultural communication (Bennett, 1986). This training model also has its limitations. ... Many scholars and trainers argue that applying a single model of intercultural training may not sufficiently prepare participants to function properly and effectively in a new cultural environment (Chen & Starosta, 1998 : 267). ...

Еще в разделе: (Показать все результаты (>144) - www.prof.msu.ru/ )

• Effective University Management:Best Practices, New Trends and Strategies
• Eleven years of independence

Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>159) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/tsirova_qfthep.pdf
• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>111) - sp.cs.msu.ru/ )

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>632) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 42, No. 2, P. 92 (2001)
• Similarity and difference of exciplexes with complete and partial electron
• Ivan Sorokin

Each row in the Particles Table describes a particle - anti-particle pair. ... 2*Spin for a doubled particle spin: 0 for scalar, 1 for spinor and 2 for vector particles. ... In this case the anti-particle "A+" is transformed by conjugated representation. ... Aux for an auxiliary field which allows to modify particle propagators. ... spin 0 case: . ... Zero mass vector particle must be marked as a gauge one using the Aux field (see below). ... is permitted for vector ( 2*spin=2 ) particle. ...

Еще в разделе: (Показать все результаты (>893) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: [LCG-ROLLOUT] [EGI BROADCAST] Decommission of gridops.org

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>166) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>5258) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/public/lyrics/cs-uwp/b/barker.horton/at_the_foot_of_yonder_mountain
• http://crydee.sai.msu.ru/public/lyrics/cs-uwp/t/tangerine.dream/kiew_mission1
• http://crydee.sai.msu.ru/public/lyrics/cs-uwp/t/tangerine.dream/kiew_mission

Copyright 1999-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash- completion -r1 prefix toolchain-funcs DESCRIPTION= Programmable Completion for bash HOMEPAGE= http://bash- completion .alioth.debian.org/ SRC_URI= http://bash- completion .alioth.debian.org/files/${P}.tar.bz2 LICENSE= GPL-2 SLOT= 0 KEYWORDS= ~alpha amd64 arm ~arm64 hppa ...

Еще в разделе: (Показать все результаты (>17980) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-1.3-r2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.1_p20141224-r2.ebuild

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>2) - bioinf.fbb.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>94) - www.msm.biophys.msu.ru/ )

• Approved Presentations

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>97) - srcc.msu.ru/ )

• Laikov, D. N. Intrinsic minimal atomic basis representation of molecular
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

... Changed: . ... TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... You can customize preferences settings to your needs: To overload a system setting, (1) do a "raw view" on TWikiPreferences , (2) copy a Set VARIABLE = value bullet, (3) do a "raw edit" of your user homepage, (4) add the bullet to the bullet list above, and (5) customize the value as needed. ... TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . ...

Еще в разделе: (Показать все результаты (>34994) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (12 vs. 13) - TWiki
• ManagingTopics - TWiki - TWiki - (printable)
• NewUserTemplate - TWiki - TWiki