... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>1440) - monkey.belozersky.msu.ru/ )

• About COGs
• SVETKA, a program for multiple sequence alignments analysis
• About this project

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6991) - mouse.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysis

HMMER . The HMMER hidden Markov model software package and other software for large-scale genome analysis using probabilistic models of proteins and RNAs, from Sean Eddy's lab at Washington University, St. Louis USA. HMMER -- Hidden Markov models for sequence profile analysis. ... COVE -- an implementation of stochastic context free grammar methods for RNA sequence/structure analysis. ... SAL Home | Other Scientific Fields | Chemistry, Biology Related . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>2519) - www.sai.msu.su/ )

• SAL- Office Software - Misc - SixPack
• SAL- Database Systems - Utilities Other DBMS - OBST
• SAL- Database Systems - Utilities Other DBMS - barracuda

... Bioinformatics Portal . GeneBee . ... Bioinformatics Portal of A.N.Belozersky Institute, . Moscow State University . Supported by the Russian Foundation for Basic Research, grant 13-07-00969-a . Original Services of GeneBee Group . Databanks screening . Sequence analysis . Screening by keywords . AliBee Multiple alignment Release 3.0 . AliGraf Graphical Alignment . AliComp Alignments Comparison . Screening by similarity Release 3.0 . ...

Еще в разделе: (Показать все результаты (>233) - www.genebee.msu.ru/ )

• Databases
• Internet Services
• BLAST Basic Overview

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>346) - graphics.cs.msu.ru/ )

• Detection of multiple object instances using Hough transform | Лаборатория

Электронная библиотека Попечительского совета . ... Brown S.M. - Bioinformatics: A Biologist's Guide to Biocomputing and the Internet . ... Название: Bioinformatics: A Biologist's Guide to Biocomputing and the Internet . Автор: Brown S.M. Аннотация: . A practical overview of bioinformatics, for researchers. ... Also discusses and evaluated programs for PCs, the Internet, and mainframes. DLC: Bioinformatics. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>15086) - lib.mexmat.ru/ )

• Raychaudhury S. - Computational text analysis for functional genomics and
• Leon D., Markel S. - Sequence Analysis in a Nutshell :: Электронная библиотека
• Siau K. - Research Issues in Systems Analysis and Design, Databases and

IMPALA: Integrating Matrix Profiles And Local Alignments 1. ... Primary preprocessing Prepare the following files : i. a collection of PSI-BLAST-generated profiles with arbitrary names and suffix .chk; ii. a collection of profile master sequences , associated with the profiles , each in a separate file with arbitrary name and a 3 character suffix starting with c; the sequences can have deflines; they need not be sequences in nr or in any other sequence ...

Еще в разделе: (Показать все результаты (>5043) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/year_04/doc/BLAST_help/rpsblast.html
• http://kodomo.cmm.msu.su/FBB/year_04/doc/BLAST_help/index.html
• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/pyr_D.txt

. Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . Описание проблемы: . Введите почтовый адрес: . Войти в систему . Регистрация . Главная . Поиск . Статистика . О проекте . Помощь . Издательство: Academic Press . Местоположение издательства: United States . ї 2011-2015 НИИ механики МГУ . Лаборатория 404. Все права защищены. обратная связь . Создать обращение

Еще в разделе: (Показать все результаты (>2547) - istina.msu.ru/ )

... lib/monomer.py . ... lib/sequence.py . ... 3.1 --- a/ lib / sequence .py Sat Oct 23 12:07:21 2010 +0400 3.2 +++ b/ lib / sequence .py Sat Oct 23 12:57:07 2010 +0400 3.3 @@ -3,6 +3,8 @@ 3.4 from Bio.PDB import PDBParser, CaPPBuilder 3.5 from allpy _pdb import Pdb 3.6 import project 3.7 +import sys 3.8 + 3.9 3.10 cappbuilder = CaPPBuilder() 3.11 3.12 @@ -17,10 +19,13 @@ 3.13 TODO: class Protein: container of multiple Sequences, 3.14 class ProteinMononer: container of multiple Monomers 3.15 3.16...

Еще в разделе: (Показать все результаты (>36181) - kodomo.fbb.msu.ru/ )

• allpy: 59320c160dae
• allpy: 9adbec7c3366 lib/project.py
• allpy: b7b963287d31 lib/project.py

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>10) - npidb.belozersky.msu.ru/ )

... Астронет | ... The second congress of the astronomical society of the former soviet union . ... Modelling the atmospheres of accretion disks . ... The distribution of old neutron stars in the galaxy . ... Compton scattering in a strong magnetic field: Resonances in the cross sections . ... Preface: "Physics of Neutron Stars" . ... Electric fields of neutron stars . ... Magnetic field decay in neutron star cores . ... The non-thermal mode of disc accretion onto the magnetosphere of a neutron star . ...

Еще в разделе: (Показать все результаты (>10795) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>399) - imaging.cmc.msu.ru/ )

• Research | Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing
• Multiscale analysis for ringing estimation | Laboratory of Mathematical Methods

Ultraviolet data (DUV) . ... The section "Original data" contains original information in analogue-digital and digital- analogue codes. The section "Data for analysis" contains pre-processed data for further analysis. Tatiana" program can be used for graph presentation of the experimental data, and "Orbitron" program - for geographical control of the data. Manual on how to use the programs and the data is in the HELP-file. ... Original data . Data for analysis . Tatiana program . ...

Еще в разделе: (Показать все результаты (>28) - cosmos.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>72) - electr003.chem.msu.ru/ )

... Quantitative analyse of tablets and syrup “Codelac bronkho” by high pressure liquid chromatography methods . Abstract A procedure was proposed for the quantitative analysis of the new original tablets and syrup “Codelac bronkho”. ... Two versions of analysis in isocratic and gradient modes were proposed for the syrup. ... Moscow University Chemistry Bulletin . 2007, Vol. ... 6, P. 395 . Copyright (C) Chemistry Dept., ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>1489) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 50, No. 3, P. 181 (2009)
• Moscow University Chemistry Bulletin Vol. 49, No. 6, P. 385 (2008)
• Moscow University Chemistry Bulletin Vol. 49, No. 2, P. 96 (2008)

Related papers . ... N. N. Nepeyvoda, Logics and programming's styles (Russian, PDF). ... Abstract. ... D. Levshin Semantic Web and PostgreSQL Integration Algorithms (Russian, PDF). ... We consider Semantic Web and PostrgreSQL DBMS integration. Analysis of known systems for using databases with Semantic Web is performed, PostgreSQL features that can be useful for integration implementation are emphasized, integration methods and algorithms are proposed, and one of these algorithms is implemented. ...

Еще в разделе: (Показать все результаты (>112) - sp.cs.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>33) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>30) - seac47-2.phys.msu.ru/ )

Evolution and Classification of GH101 Family Glycoside Hydrolases: Four Years Later Daniil G. Naumoff S. N. Winogradsky Institute of Microbiology, Russian Academy of Sciences, Prospekt 60-letiya Oktyabrya 7/2, Moscow 117312, Russia; daniil_naumoff@yahoo.com Recent progress in geno me sequencing resulted in a rapid growth of the sequence databases. The number of known representatives of all protein families has increased dramat ically. ... This family was described in 2005 [2]. ...

Еще в разделе: (Показать все результаты (>314) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/178.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/120.pdf