... Pyrococcus furios (14506) [f] 149 41.9 3.6e-05 AE010241 AE009950 |AE010241| ... Pyrococcus furiosus DSM 3 (14506 nt) initn: 141 init1: 116 opt : 149 Z-score: 163.3 bits : 41.9 E(): 3.6e-05 banded Smith-Waterman score: 149; 78.8% identity (78.8% similar) in 52 nt overlap (19-69:9586-9637) 10 20 30 40 U00096 TGGTGCTGATACCCAGAGTCGAACTGGGGACCTCACCCTTACCAAGGG : :::: ::::::: : ::::::::: : AE0102 TTATTAAAAACATGGAGCCCCGGCCGGGCTTTGAACCCGGGACCTGCCGCTTACCAAGCG 9560 9570 9580 9590 9600 9610 50 60...

Еще в разделе: (Показать все результаты (>1961) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~sds/Supplement_materials/term3/block1/fasta_proverka.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/fasta34.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/fasta.out

. Электронная библиотека . механико-математического факультета . Московского государственного университета . Главная Ex Libris Книги Журналы Статьи Серии Каталог Wanted Загрузка ХудЛит Справка Поиск по индексам Поиск . Мехматянам . Первый курс . Второй курс . Третий курс . Четвертый курс . Пятый курс . Поиск по указателям . Результат поиска . Книга . Страницы для поиска . Хорн Р., Джонсон Ч. - Матричный анализ . 183 . Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . | | О проекте

Еще в разделе: (Показать все результаты (>3455) - lib.mexmat.ru/ )

• Поиск книг, содержащих Подобные алгебры [similar algebras] :: Электронная
• Поиск книг, содержащих Алгебры однотипные (similar algebras) :: Электронная
• Webster A.G. - On a Condition for Helmholtzs Equation Similar to Lames ::

. Album : asv-album :: Travels to distant places and countries :: 1997/08 Kyoto, Nara (Japan) :: 21/08 Toji temple flea market, Gion district . Up . << Prev . Near the temple entrance similar monk figures can be seen alive. Next >> . Photo album generated by photo album generator a MarginalHack by David on Tue Jun 23 14:46:14 2015 .

Еще в разделе: (Показать все результаты (>1924) - crydee.sai.msu.ru/ )

• Image: Place to drink and wash hands. Similar ones are present at every shrine.
• Image: Very similar to The Cat Mountain in Crimea!
• Mean power spectrum

... Emerging evidence for a similar role of glutamate receptors in the nervous and immune systems. ... The role of glutamate receptors in synaptic transmission and excitotoxicity in the nervous system is well established. ... We conclude that glutamate is involved in signaling in immunocompetent cells and that the expression of both ionotropic and metabotropic glutamate receptors may have regulatory functions in immunocompetent cells, as well as in the nervous system. ...

Еще в разделе: (Показать все результаты (>23) - biochem.bio.msu.ru/ )

• phyA-GFP is spectroscopically and photochemically similar to phyA and comprises
• Fern Adiantum capillus-veneris phytochrome 1 comprises two native photochemical

... WebTopicNonWikiTemplate 12 - 2006-11-12 - Main.TWikiContributor . ... The topic 'WebTopicNonWikiTemplate' you are trying to access does not exist, yet. ... Similar topics in this web (if any): . WebTopicNonWikiTemplate" limit="16" scope="topic" web="TWiki" nosearch="on" nototal="on" noheader="on" order="modified" reverse="on" header="" --> List more similar topic in this web . ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.WebTopicNonWikiTemplate . ...

Еще в разделе: (Показать все результаты (>27172) - dualopt1.cmm.msu.ru/ )

• None - TWiki - TWiki
• OfficeLocations - Main - TWiki - (printable)
• GoodStyle - Main - TWiki - (printable)

. Published since 1829 . Editor in Chief: A.S. Severtsov . Editorial Board :V.N. Pavlov (Assistant Editor), Yu.A. Dubrovsky, F.Ya. Dzerzhinsky, R.D. Zhantiev, V.G. Krivenko, M.V. Mina, E.N. Mirzoyan, O. P.Poltaruha, D.D.Sokoloff, V.G. Onipchenko, A.V. Sviridov, G.N. Simkin, M.V. Nilova (Secretary), P.S. Tomkovich.

Еще в разделе: (Показать все результаты (>88) - herba.msu.ru/ )

• The variability of different Drosera

Network Working Group Pradeep Kumar Xplorer Internet-Draft Intended status: Standards Track Individual Expires: Jul 17, 2016 Jan 17, 2016 Need for an httpi intelligent service draft-httpi-11 Abstract This document describes the need for an httpi protocol similar to https used for intelligent surfing of information. ... General Information of the service .. ... I propose an httpi:// service that would allow dynamic links that can be updated by the httpi service in the text that you are viewing. ...

Еще в разделе: (Показать все результаты (>12143) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc480.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc480.txt
• http://mirror.msu.net/pub/gentoo-portage/dev-libs/gmp/files/gmp-4.2.1-s390.diff

Geometrical core (core) is a maximal set of alignment positions such that C atoms in these positions are disposed similarly in ALL input protein chains. ... Minimal core size (#aa's) . ... Alternative core new atoms (%) . ... Geometrical core is a maximal set of alignment positions such that C atoms in these positions are disposed similarly in ALL input protein chain. ... Each input sequences is aligned to the corresponding sequence obtained from the ATOM section of the protein chain in the PDB file. ...

Еще в разделе: (Показать все результаты (>6942) - mouse.belozersky.msu.ru/ )

• 1QPI biounits

... Distances between sequences . It is considered that the space, where all amino acids and sequences are analysed, is a metric one. ... When the distance between amino acids is entered, it is rather easy to consider such measure as pair distance between sequences in any position of alignment (in fact, this distance is just a distance between two amino acids). As distance is an additional quantity, pair distance between sequences on all alignment positions can be easily defined. ...

Еще в разделе: (Показать все результаты (>19) - monkey.belozersky.msu.ru/ )

• HTH_3_main

T03-P12 STUDY OF IRON SPECIATION IN HUMIC-BASED IRON FERTILIZERS USING MжSSBAUER SPECTROSCOPY T.Sorkina1, D.Pankratov1, O.Philippova2, N.Kulikova2, Yu.Perfiliev1, I.Perminova1 2 Department of Chemistry, Lomonosov Moscow State University, Moscow, Russia Department of Soil Science, Lomonosov Moscow State University, Moscow, Russia bioavailable and have similar chemical surrounding as chelated iron. ... Iron humates were obtained using potassium humate of leonardite and iron sulfate under pH control. ...

Еще в разделе: (Показать все результаты (>62) - mgumus.chem.msu.ru/ )

. The mail program described here is known as mail (or ucb/mail ) and is available on many systems. Some systems provide a similar mail program called mailx which is an improved version of mail . If necessary, use the command mailx instead of mail . Most mail programs work in a similar manner, so you will find the information on using mail useful when you come to use some other mailer. Other mail programs . Mail program modes . Mail program files .

Еще в разделе: (Показать все результаты (>44) - comet.sai.msu.ru/ )

• More about the UNIX operating system
• Modern variants of UNIX
• UNIXhelp Glossary - "F"

NPG-explorer : a new tool for nucleotide pangenome construction and closely related prokaryotic genomes analysis Boris Nagaev2, Maxim Nikolaev2, Andrei Alexeevski 1 1,2,3* A.N.Belozersky Institute Of Physico-Chemical Biology and 2Faculty ... @gmail.com Moscow State University, Moscow 119991, Russia 3Scientific Research Institute of System Analysis (NIISI RAS), Moscow Genomes of closely related bacteria have highly similar sequences of orthologous ... Blocks are classified into four categories. ...

Еще в разделе: (Показать все результаты (>104) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/164.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/236.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/4.pdf

... Главная -> Фильмы -> Bande du Drugstore, La . ... Фильмы . ... Bande du Drugstore, La . ... Fran?ois Armanet . ... Marion Armanet . ... Romain Deroo . ... Поколение 60-х верило вљсебя, хотело изменить мирљи думало, чтољмолодость никогда нељкончится. ... Скучающая французская молодежь наслаждается жизнью вљночных клубах Парижа иљна курортах Нормандии подљмузыку Ареты Франклин, ?Кинкс?, ... Филиппа покоряют еељчерные глаза, иљни слова нељговоря ониљначинают страстно целоваться подљмузыку Ареты...

Еще в разделе: (Показать все результаты (>254) - kinfo.ru/ )

• Sly 2: Band of Thieves - Фильмы - Kinfo.ru
• One Man Band - Фильмы - Kinfo.ru
• The Speckled Band - Фильмы - Kinfo.ru

Graphite-bearing carbonatite of Guli massif. ... This carbonatite is anhimonomineral calcitic rock (sevite) with minor amounts of dolomite, phlogopite, amphibole and K-feldspar. ... Graphite (black) intergrowth with phlogopite (light-grey) in calcite (grey). ... Dolomite contain 3-4 % of calcite component. ... P-T and f(O2)-T conditions for dolomite+K-feldspar+calcite+phlogopite+graphite association estimated by thermochemical calculations with program complex BAYES (Chatterjee et al., ...

Еще в разделе: (Показать все результаты (>359) - geo.web.ru/ )

• Trusov Sergey's homepage The influence of boundary layer effects on the melt
• Untitled Document

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... 2011 Mode of propagation of optical radiation with self-similar pulse shape in layered medium with nonlinear absorption . Trofimov Vyacheslav A. , Matusevich Olga V. , Smotrov Dmitry A. в сборнике Proceedings of SPIE - The International Society for Optical Engineering , с. 80951K DOI . ...

Еще в разделе: (Показать все результаты (>406) - istina.msu.ru/ )

• Smotrov D. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Band I.M. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Kakihana M. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Thus, the development of a method of synthesis of signals of finite duration, optimal in the sense of maximum concentration of energy in specified frequency ranges, is the actual problem. ... Erik Larsen, Ronald M. Aarts, "Audio Bandwidth Extension: Application of Psychoacoustics, Signal Processing and Loudspeaker Design", John Wiley & Sons, ISBN: 0-470-85864-8, September 2004. ... Time-frequency decomposition, 2. ... Shaping of the energy spectrum envelope of high-frequency content, 4. ...

Еще в разделе: (Показать все результаты (>27) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/ComplexCortexTransform09.pdf

... Oriented oxide heterostructures including substrate, buffer and metal- conducting layers were prepared by band flash evaporation MOCVD, each in a continuous deposition run, and characterized by XRD, SNMS, HREM, measurements of the electric properties. ... Oriented ferroelectric PbTiO3 films were deposited on CaRuO3 electrode layers obtained. The properties of the multilayered films deposited in a continuous run and at several consequent attempts, with and without buffering, are compared. ...

Еще в разделе: (Показать все результаты (>146) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 51, No. 3, P. 227 (2010)
• Moscow University Chemistry Bulletin Vol. 53, No. 4, P. 257 (2012)
• Moscow University Chemistry Bulletin Vol. 42, No. 6, P. 408 (2001)

... Added script utils/convert_homology.py to convert homology files for similar alignments. author . ... 2 from allpy import dna . ... 20 blocks = [] . 21 in_block = False . ... 24 in_block , was_in_block = is_good_window ( window ), in_block . 25 if in_block and not was_in_block : . ... Block . from_alignment ( alignment , columns = list ( window )) . ... 32 def blocks_markup ( alignment , blocks ): . ... in_block for column in alignment . ... 52 blocks_markup ( alignment , blocks ), . ...

Еще в разделе: (Показать все результаты (>3311) - kodomo.fbb.msu.ru/ )

• allpy: bf873e4054c2 test/usecase2.py
• allpy: bf873e4054c2
• allpy: Makefile annotate

... Apache HTTP Server Version 2.0 . ... This Multi-Processing Module (MPM) implements a non-threaded, pre-forking web server that handles requests in a manner similar to Apache 1.3. ... Apache always tries to maintain several spare or idle server processes, which stand ready to serve incoming requests. ... Maximum number of idle child server processes . ... Minimum number of idle child server processes . ... The MinSpareServers directive sets the desired minimum number of idle child server processes. ...

Еще в разделе: (Показать все результаты (>151) - itpm.msu.su/ )

• Floppies
• mod_auth - Apache HTTP Server
• Selecting the backup tool

... public class Attribute . ... They have a name, type and an array of values. ... Attribute (java.lang.String name, double value) . ... If the value represents an array type, returns the Class object representing the component type of the array; otherwise returns null. int . ... Constructor Detail public Attribute (java.lang.String name, java.lang.Number value) . ... public Attribute (java.lang.String name, double value) . ... public Attribute (java.lang.String name, java.lang.Object theValue) . ...

Еще в разделе: (Показать все результаты (>21) - angel.cs.msu.su/ )