SAI 175 anniversary . ... Moscow University . Search for in SAI Moscow University Search for in Russian astronomical resources . ... SAI Astronomical Databases . ... Browse SAI Software archive(ftp.sai.msu.su) . ASTRONET.RU - Russian Astronomical Network (available in translit also) . ... SAI Supernovae Research Group . ... Department of the Galaxy and Variable Stars (in Russian) . Sternberg Astronomical Institute Seminars . ... All-Russian Astronomical Olympiad (in Russian) . ...

Еще в разделе: (Показать все результаты (>1711) - www.sai.msu.su/ )

• SAI SN RESEARCH GROUP

... Государственный Астрономический Институт имени П.К. Штернберга МГУ . ... Семинары ГАИШ . ... Государственный астрономический институт им. П.К.Штернберга (ГАИШ) научно-исследовательский институт, являющийся одним из подразделений МГУ им. М.В. Ломоносова . ... 11 декабря 2006 года исполнилось 175 лет со дня создания на Пресне Астрономической обсерватории Московского университета, ставшей впоследствии базой для формирования Государственного астрономического института им. П.К. Штернберга (ГАИШ МГУ). ...

Еще в разделе: (Показать все результаты (>107) - sai.msu.ru/ )

... Online Services | ... CDFE => Online Services => Chart of Nucleus Shape Parameters . Nucleus quadrupole deformation parameter ? ... At.Data Nucl.Data Tables 78, 1 (2001)] . ... N.J.Stone, At.Data Nucl.Data Tables, 90 75 (2005)] . ... Nucleus charge radii: . ... Nadjakov E. G., Marinova K. P. and Gangrsky Y. P., At.Data Nucl.Data Tables, 56, 133(1994)] (updated 2015) . ... I. Angeli, At.Data Nucl.Data Tables, 87, 185 (2004), updated 2008] . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>52) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online Services => Relational ENSDF
• CDFE - Centre for Photonuclear Experiments Data - Home page

... Influence of genetic algorithm parameters on the docking efficiency with the SOL program" . Katkova E.V. The key genetic algorithm parameters and their influence on the docking efficiency implemented in the SOL parallel program are analyzed. ... The optimal parameters of the genetic algorithm are obtained for the single-run mode, i.e., for the docking of a single molecule, and for the virtual screening mode, i.e., for the docking of compound libraries. ... PostScript (in Russian) (0.99MB) . ...

Еще в разделе: (Показать все результаты (>619) - num-meth.srcc.msu.ru/ )

• "An algorithm of assigning the force parameters to atoms of organic molecules
• Comparison of computational efficiency of explicit and implicit schemes for the
• A reconfigurable computer system based on FPGAs with liquid cooling

... 18 27 апреля 2016 года . ... СЕМИНАР ПО МЕХАНИКЕ СПЛОШНЫХ СРЕД . В среду, 13 апреля 2016 г., в кинозале Института механики МГУ в 12.00 состоится очередное заседание семинара по механике сплошных сред под руководством А.Г. Куликовского, В.П. Карликова и О.Э. Мельника. ... версия для печати 2016-04-07 . ... 260 заседание семинара ?Физико-химическая кинетика в газовой динамике? состоится в четверг 07 апреля 2016 года (11 часов, кинозал Института механики МГУ) . ... НИИ механики МГУ, 2002 2016. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>347) - graphics.cs.msu.ru/ )

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>121) - selena.sai.msu.ru/ )

• Svetlana G. Pugacheva

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>224) - ics.org.ru/ )

CALCULATION OF THE PARAMETERS OF MICROSCOPIC OPTICAL POTENTIAL BY ASYNCHRONOUS DIFFERENTIAL EVOLUTION ALGORITHM Zhabitskaya E.I ., Zhabitsky M.V.1 , Zemlyanaya E.V., Lukyanov K.V. Dubna University, Russi, Dubn; Joint Institute for Nuclear Research, LIT, Russia, Dubna ,141980, Joliot-Curie 6 Joint Institute for Nuclear Research, LNP, Russia, Dubna ,141980, Joliot-Curie 6; Rock Flow Dynamics, Russi, Moscow 1 Differential ... J. of Global Optimization 11,1997, Pp. ...

Еще в разделе: (Показать все результаты (>279) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc24959/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc18923/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc185320/eng.pdf

Eygene Ryabinkin rea at grid.kiae.ru . Wed Sep 18 18:42:50 MSK 2013 . Previous message: [RU-NGI] GLUE2 parameters . Next message: [RU-NGI] GLUE2 parameters . Messages sorted by: [ date ] [ thread ] [ subject ] [ author ] . ... Eygene Ryabinkin, National Research Centre "Kurchatov Institute" Always code as if the guy who ends up maintaining your code will be a violent psychopath who knows where you live. ... More information about the RU-NGI mailing list . ...

Еще в разделе: (Показать все результаты (>1425) - theory.sinp.msu.ru/ )

• Parameter section
• Independent parameters of the model
• Constraints between the parameters

... The Study of Acoustic Nonlinearity Parameter Tomography in Reflection Mode . ... Based on the theory of propagation of reflected second harmonics in the layered medium and the insert-substitution method of finite amplitude sound wave, the computer simulation of nonlinearity parameter tomography from calculated reflected second harmonic data and filtered convolution algorithm used in the conventional CT technique is reported and the images of B/A for several biological specimens are reconstructed. ...

Еще в разделе: (Показать все результаты (>705) - acs366.phys.msu.su/ )

• AUTHOR : Mironov M
• AUTHOR : Borisov Y
• AUTHOR : Gong X

New achievements in Development of Multidimensional Data Acquisition, Processing and Visualization DAQPROVIS M. MorhА *, 1, 2 , V. Matousek 1, 2 1, 3 , J. Kliman 1, 2 , 1 Institute of Physics, Slovak Academy of Sciences, Bratislava, Slovakia 2 Flerov Laboratory of Nuclear Reactions, JINR, Dubna, Russia 3 Laboratory of High Energies, JINR, Dubna, Russia * E-mail: morhac@savba.sk ACAT - 2002 I. Turzo c 1, 3 , . ... The channels are displayed as balls. ... Four-parameter experimental spectrum. ...

Еще в разделе: (Показать все результаты (>68) - acat02.sinp.msu.ru/ )

... ISSN: 2070-1721 July 2012 SHA-2 Data Integrity Verification for the Secure Shell (SSH) Transport Layer Protocol Abstract This memo defines algorithm names and parameters for use in some of the SHA-2 family of secure hash algorithms for data integrity verification in the Secure Shell (SSH) protocol. It also updates RFC 4253 by specifying a new RECOMMENDED data integrity algorithm. Status of This Memo This is an Internet Standards Track document. ...

Еще в разделе: (Показать все результаты (>15568) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc6668.txt.pdf
• Index of /pub/gentoo-portage/dev-perl/MooseX-Role-Parameterized/
• wdiff rfc7826-mediatypereg-iana.txt rfc7826-mediatypereg-doc.txt

Электронная библиотека Попечительского совета . ... Bishwal J.P. - Parameter Estimation in Stochastic Differential Equations . ... Название: Parameter Estimation in Stochastic Differential Equations . ... Parameter estimation in stochastic differential equations and stochastic partial differential equations is the science, art and technology of modelling complex phenomena and making beautiful decisions. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>12324) - lib.mexmat.ru/ )

• Lobo F.J., Lima C.F., Michalewicz Z. - Parameter Setting in Evolutionary
• Lobo F.G., Lima C.F., Michalewicz Z. - Parameter Setting in Evolutionary
• Englezos P., Kalogerakis K. - Applied parameter estimation for chemical

... To define in detail the molecular mechanism of NAD+-dependent formate dehydrogenase, the pH dependences of various kinetic and spectroscopic parameters have been studied: Vmax, Km (NAD+), Km (formate), inhibition constants for structural analogues of substrate (NO3-) and product (CNS-, CNO-, N3-), CD and fluorescence properties. The value of Vmax, rate-limiting hydride transfer, is nearly constant throughout the entire pH range of enzyme stability (6.0-11.2) but decreases below 6. ...

Еще в разделе: (Показать все результаты (>114) - www.enzyme.chem.msu.ru/ )

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>34) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Agrachev.pdf

... Calculations of at least two runs with different values of a parameter are required in order to discover to what extent the results depend on the , if at all. ... In order to study how the final statistical distributions depend on the initial functions, the method of Green functions is used. ... Then we can restore any distribution on this parameter (with a certain accuracy) by summing the results for each interval with the appropriate weight. ...

Еще в разделе: (Показать все результаты (>602) - xray.sai.msu.ru/ )

• Initial Distributions of Binary Parameters
• Initial parameters of compact stars
• Other parameters of the evolutionary scenario

... Next: Plane tab Up: Client Previous: Connection to a Server Contents Index . Figure 2.4: Scan parameters. STM mode of operation. ... AFM mode of operation. ... All scan parameters can be configures in Parameters window (pic. ... Client part of `` FemtoScan '' software allows to control microscope operating in three different scanning modes - tunneling mode(STM), atomic-force mode (AFM) and resonance atomic-force (RAFM). ... It(Z) tab (STM mode), F(Z) tab (AFM mode), D(Z) tab (RAFM mode). ...

Еще в разделе: (Показать все результаты (>109) - www.spm.genebee.msu.ru/ )

• Parameters of 3D Images
• Microscope Parameters Data
• Index

... transaction-id,initial-requester-id,person-or-institution-symbol,person . ... transaction-id,initial-requester-id,name-of-person-or-institution,name-of-person . transaction-id,initial-requester-id,name-of-person-or-institution,name-of-institution . ... delivery-address,postal-address,name-of-person-or-institution,name-of-person . delivery-address,postal-address,name-of-person-or-institution,name-of-institution . ... billing-address,postal-address,name-of-person-or-institution,name-of-person . ...

Еще в разделе: (Показать все результаты (>574) - oit.cmc.msu.ru/ )

• Dealing with a Variable Number of Arguments/Optional Parameters
• Assuring Write Safety for Other Parameters
• pdf_set_parameter