... Roitberg Y. - Elliptic Boundary Value Problems In The Spaces Of Distributions . ... Название: Elliptic Boundary Value Problems In The Spaces Of Distributions . ... Contains chapters on areas such as functional spaces, a theorem on complete collection of isomorphisms, elliptic problems with power singularities on right-hand sides, and elliptic boundary-value problems for systems of equations. ... Regular elliptic problem 153 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 ...

Еще в разделе: (Показать все результаты (>17945) - lib.mexmat.ru/ )

• von Collani E., Drager K. - Binomial Distribution Handbook for Scientists and
• Поиск книг, содержащих Полное (по Эресману) распределение (Ehresmann-complete
• H?rmander L. - The Analysis Of Linear Partial Differential Operators III ::

Next: Building sendmail.cf Up: Installing sendmail Previous: Installing sendmail . First, you have to unpack the archive file in some safe location: . If you have a ``modern'' tar, for example from a recent Slackware Distribution, you can probably just do a tar -zxvf filename.tgz and get the same results. Unpacking the archive creates a directory named sendmail5.65b+IDA1.5+mailx5.3b. In this directory, you find a complete installation of sendmail+IDA plus a binary of the mailx user agent. ...

Еще в разделе: (Показать все результаты (>351) - itpm.msu.su/ )

• The Linux Kernel (Copyright Notice)
• Terms and Conditions for Copying, Distribution, and Modification
• The /usr filesystem

Copyright 1999-2016 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=6 BASHCOMP_P =bashcomp-2.0.2 inherit versionator DESCRIPTION= Programmable Completion for bash HOMEPAGE= https://github.com/scop/ bash-completion SRC_URI= https://github.com/scop/ bash-completion /releases/download/${PV}/${P}.tar.xz https://bitbucket.org/mgorny/bashcomp2/downloads/${ ...

Еще в разделе: (Показать все результаты (>47630) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.1_p20141224-r2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.1_p20141224-r1.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.1-r2.ebuild

... Line: 1 to 1 . Welcome to TWiki, a web-based collaboration tool, document management tool, and knowledge base tool. ... Changed: . Complete documentation for Webmasters, system administrators, anyone interested in installing and fine-tuning a TWiki site. ... TWikiVariables . ... A collection of single-page topics: clear, concise how-to guides designed for busy TWiki users. ... TWikiVariables : Manipulate text, graphics, calculations, and more with simple expanding text strings. ...

Еще в разделе: (Показать все результаты (>34519) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (17 vs. 21) - TWiki
• %TOPICTITLE% (16 vs. 20) - TWiki
• %TOPICTITLE% (18 vs. 22) - TWiki

... annotate . ... 1 import sys . bnagaev@83 . ... 3 from allpy.alignment import Alignment . ... 4 from allpy.block import Block . ... 6 p = Alignment ( open ( 'test.fasta' )) . ... 7 print "alignment length: %i " % len ( p ) . bnagaev@110 . ... bnagaev@120 . ... pdb_chain_add ( open ( '1jcc.pdb' ), '1jcc' , 'B' ) . ... pdb_chain_add ( open ( '1kfm.pdb' ), '1kfm' , 'A' ) . ...

Еще в разделе: (Показать все результаты (>88992) - kodomo.fbb.msu.ru/ )

• allpy: lib/block.py annotate
• allpy: .hgtags annotate
• allpy: .hgignore annotate

by Margarita Dzhalalova It is known that the pressure difference values for a round parachute are constant over total canopy, then for a square parachute the values of pressure difference are non-uniform along radial ribbons differing even from each other and depending mainly on certain sets of line lengths, and therefore square parachutes attain different shapes from each other ( Fig.1 - photo of var.1 and var.2). ... Distribution of pressure coefficient along radial ribbons of square parachute. ...

Еще в разделе: (Показать все результаты (>10) - margaret.imec.msu.ru/ )

• Air-Permeability Influence on Pressure Distribution Character
• Scientific Achievements

Below is a list of all of the modules that come as part of the Apache distribution. ... mod_actions Apache 1.1 and up . ... Sending files which contain their own HTTP headers . ... User authentication using text files . ... User authentication using Berkeley DB files . ... User authentication using DBM files . ... mod_browser Apache 1.2.* only . ... Replaced by mod_setenvif in Apache 1.3 and up . ... Logging of User Agents . ... Replaced by the mod_log_config module in Apache 1.2 and up . ...

Еще в разделе: (Показать все результаты (>75) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules

... Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. ... Redistribution and use of this software, with or without modification, is permitted provided that the following conditions are met: 1. ... All related source code must be included. ... Various other copyrights apply. ...

Еще в разделе: (Показать все результаты (>5207) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/m-o/missun.txt
• http://crydee.sai.msu.ru/public/XG/songs/michael_walthius/GS/dreaming.txt
• http://crydee.sai.msu.ru/ftproot/pub/comp/os/os2/hobbes/incoming/jalv24q3.txt.txt

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>179) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и

... Implementation of the lattice Boltzmann method without stored distribution functions on GPU" . Bikulov D.A., Senin D.S. A new algorithm for the lattice Boltzmann method optimized for GPU is proposed. The algorithm significantly reduces the DRAM memory amount required for operation in the 2D and 3D cases. ...

Еще в разделе: (Показать все результаты (>402) - num-meth.srcc.msu.ru/ )

• "Mathematical modeling of the formation of suffocation conditions in shallow
• Numerical modeling of conjugated point distribution along a geodesic with
• "Load balancing of processors when solving the problems of fluid and gas

... Species distribution . ... According to Pfam database there have been found 487 ETS genes to date, most of which turned out to belong to different species of animal kingdom. ... The following table shows the number of ETS genes present in genomes of most intensively studied species. The number of ETS genes found in genomes of most intensively studied species . ... The following table shows the number of well studied ETS proteins and their distribution among species. ... ETS1, SPI1, SPIB . ...

Еще в разделе: (Показать все результаты (>290) - monkey.belozersky.msu.ru/ )

• HTH3_species_distribution
• ETS_all_contacts alignment
• ETS numeration assumed

Studying islands is a very interesting subject for ecology, systematic and biogeography. ... These islands are generally small and do not have a big list of vascular plant species, which removes a lot of complications in their study. ... This is also true for most of the islands of the Tchupa gulf and to the ones East and Northeast from its mouth in the Kiv gulf and east from Sidorov island. ... Mainland-gulf (12%) - Plants with this areal type are found on al gulf islands we studied. ...

Еще в разделе: (Показать все результаты (>213) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>18) - io.cmc.msu.ru/ )

Back to homepage >> . ... key words: [ melt inclusions, experiment, diffusion, boundary layer effect ] . ... In order to distinguish an influence of the boundary effects on the composition of melt inclusions, the experiment on growth of alkali feldspar (Fsp) crystal in the haplogranitic system (Q-Ab-Or) was performed. ... Estimation of an influence of the boundary effect on melt inclusion composition . ... The larger inclusion the weaker its influence on the boundary layer. ...

Еще в разделе: (Показать все результаты (>565) - geo.web.ru/ )

• The influence of boundary layer effects on the melt inclusions compositions.

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... 2005 Approaches to perfect/complete scattering experiments in atomic and molecular physics . Kleinpoppen H. , Lohmann B. , Grum-Grzhimailo A. , Becker U. в журнале Advances in atomic, molecular, and optical physics , том 51, с. 471-534 DOI . ... LOHMANN B. , HERGENHAHN U. , KABACHNIK NM . ...

Еще в разделе: (Показать все результаты (>3645) - istina.msu.ru/ )

• Gaister A.V. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Becker U. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Kleiman U. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>105) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

Change of single-position fitness landscapes and its causes Georgii A. Bazykin Institute for Information Transmission Problems of the Russian Academy of Sciences (Kharkevich Institute), Bolshoy Karetny pereulok 19, Moscow 127994, Russia, gbazykin@iitp.ru The dimensionality of complete genome-level fitness landscapes is huge, and studying their shape is hard. ... These patterns are informative of the changes of amino acid propensities and, indirectly, of the shape of the fitness landscape. ...

Еще в разделе: (Показать все результаты (>270) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/149.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/162.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/128.pdf

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>49) - cdfe.sinp.msu.ru/ )

• CDFE provides the major photonuclear databases. Online Services.
• CDFE - Centre for Photonuclear Experiments Data - Home page

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3772) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt

Revolution in VUV and X-ray physics Free electron lasers (FEL) FLASH ­ Free Electron Laser in Hamburg (2005) : flux 1013 photons/ pulse Intensity 1013 W/cm2 Photon energy 13 eV ­ 100 eV Pulse duration 10-50 fs LCLS - Linac Coherent Light Source ( 2009 ): flux 1012 photons/ pulse Photon energy 800 eV ­ 8000 eV Pulse duration 100-200 fs XFEL at DESY (2013) Intensity 1016 W/cm2 Photon energy 200 eV - 10 keV Pulse duration 100 fs Free ... J. Phys. B, 41, 165601, 2008 Coincidence ! ...

Еще в разделе: (Показать все результаты (>247) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/190809/Early%20physics%20with%20Atlas%20at%20LHC.pdf
• The European X- Ray Free-Electron Laser