Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... VarQUERYSTRING 3 - 2005-03-27 - Main.TWikiContributor . ... name="TWikiVariables" . ... String of all the URL parameters that were on the URL used to get to the current page. ... Note: URLs built this way are typically restricted in length, typically to 2048 characters. If you need more space than this, you will need to use an HTML form and %QUERYPARAMS% . ... Related: QUERYPARAMS , URLPARAM . ...

Еще в разделе: (Показать все результаты (>50469) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (1 vs. 2) - TWiki
• VarQUERYSTRING - TWiki - TWiki - (printable)
• VarQUERYSTRING - TWiki - TWiki

You are here: Foswiki > System Web > Macros > VarQUERYSTRING (19 Sep 2010, ProjectContributor ) E dit A ttach . String of all the URL parameters that were on the URL used to get to the current page. For example, if you add ?name=Samantha;age=24;eyes=blue to this URL you can see this in action. ... Users . ... User Reference . ... Admin Maintenance . ... User Documentation . ... Copyright by the contributing authors. All material on this site is the property of the contributing authors. ...

Еще в разделе: (Показать все результаты (>48977) - wiki.cmc.msu.ru/ )

• JQueryUIDialog < System < Foswiki
• VarENCODE < System < Foswiki

On this page: . ... Events . ... A call to $(foo).dialog() will initialize a dialog instance and will auto-open the dialog by default. If you want to reuse a dialog, the easiest way is to disable the "auto-open" option with: $(foo).dialog({ autoOpen: false }) and open it with $(foo).dialog('open') . ... This will initialize the following css classes to build the dialog widgets: . ... This event is triggered when dialog is created . ... This topic: System > JQueryPlugin > JQueryUIDialog . ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• VarENCODE < System < Foswiki

... Which substance can enter redox reaction with FeCl 3 and exchange reaction with AgNO 3 ? Write both reactions. (2 points) [Solution] . ... Write two S E reactions with the least active substance. (2 points) [Solution] . ... Write the reactions involved in the following sequence of transformations: . Determine the functional groups X and Y. Specify the conditions of all reactions. (3 points) [Solution] . ... Example Problems in Chemistry for the Entrance Exams ( preliminary round ) . ...

Еще в разделе: (Показать все результаты (>1062) - chem.msu.ru/ )

• Entrance Examinations - Preliminary Round

Online Services | ... Nuclear Wallet Cards" . USA National Nuclear Data Center - NNDC . ... Nuclei Selection: . All nuclei Only even Only odd . ... Decay Type: . decay . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>49) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Online Services => Nucleus Ground State Parameters

Электронная библиотека Попечительского совета . ... Smith R.C., Demetriou M.A. - Research Directions in Distributed Parameter Systems . ... Название: Research Directions in Distributed Parameter Systems . Авторы: Smith R.C., Demetriou M.A. Аннотация: . ... Research Directions in Distributed Parameter Systems is intended for graduate students, academic and industrial research scientists, and program managers from funding agencies supporting research focused on distributed parameter systems. ...

Еще в разделе: (Показать все результаты (>20507) - lib.mexmat.ru/ )

• Aster R.C., Borchers B., Thurber C.H. - Parameter Estimation and Inverse
• Tarantola A. - Inverse problem theory and methods for model parameter
• Dolgachev I. - Lectures on Invariant Theory :: Электронная библиотека

... New parameter parsing API: This chapter documents the new Zend parameter parsing API introduced by Andrei Zmievski. ... It greatly simplifies the process of receiving parameteres, but it has a drawback in that it can't be used for functions that expect variable number of parameters. ... The third argument is a string that specifies the number and types of arguments your function is expecting, similar to how printf format string specifies the number and format of the output values it should operate...

Еще в разделе: (Показать все результаты (>1331) - oit.cmc.msu.ru/ )

• sprintf
• substr
• Declaring Exported Functions

Solution of the Stokes problem with parameter by the use of iteration of boundary conditions" . Kargin A.V. An iterative method for solving the Stokes problem with parameter in a rectangular domain is proposed and substantiated. The convergence rate of the method does not depend on the parameter and on the ratio of the rectangle sides. Some numerical results are discussed for a test problem on a cavern. PostScript (in Russian) (639KB) . PDF (in Russian) (380KB) . ...

Еще в разделе: (Показать все результаты (>595) - num-meth.srcc.msu.ru/ )

• "Methods of choosing a regularization parameter in the problem of linear
• "A numerical method of parameter reconstruction in the FitzHugh-Nagumo and
• "The parameter continuation method and its application to optimal control

... Perturbation Theory has a long tradition. ... The stability of an equilibrium (or periodic) state of a system depends in the first instance on the eigenvalues of the system linearized about that state. ... After an introductory chapter on stability theory, a long Chapter 2 deals with bifurcation analysis of eigenvalues of matrices depending on several parameters: this is the core of the book on which most of the rest depends. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• Multiparameter Stability Theory with Mechanical Applications

Y.Lyublev lublev at itep.ru . ... Previous message: [RU-NGI] GLUE2 parameters . Next message: [RU-NGI] UMD bug info-dynamic-pbs-3.0.1-1 . ... /LCG/GlexecDeployment#Check_list ) [ root at ce3 Polices]# pap-admin lp default (local): resource http ://authz-interop.org/ xacml /resource/resource-type/wn { obligation http ://glite.org/ xacml /obligation/local-environment-map { } action http ://glite.org/ xacml / ... More information about the RU-NGI mailing list . ...

Еще в разделе: (Показать все результаты (>1510) - theory.sinp.msu.ru/ )

• Independent parameters of the model
• [RU-NGI] GLUE2 parameters
• Structure of LanHEP input file

Next: Items that Define Paths Up: The sendmail.cf File Previous: An Example sendmail.m4 File . A few or the items in the sendmail.m4 file are required all the time; others can be ignored if you can get away with defaults. The following sections describe each of the items in the example sendmail.m4 file in more detail. Items that Define Paths . Defining the Local Mailer . ... Domain Name Service Related Items . Defining Names the Local System is Known by . UUCP-Related Items . ...

Еще в разделе: (Показать все результаты (>598) - itpm.msu.su/ )

• mod_charset_lite - Apache HTTP Server
• mod_ext_filter - Apache HTTP Server
• All About ifconfig

... Apache HTTP Server Version 2.0 . ... Specify character set translation or recoding . ... charset_lite_module . ... CharsetDefault . ... The character set name parameters of CharsetSourceEnc and CharsetDefault must be acceptable to the translation mechanism used by APR on the system where mod_charset_lite is deployed. ... The ImplicitAdd keyword specifies that mod_charset_lite should implicitly insert its filter when the configuration specifies that the character set of content should be translated. ...

Еще в разделе: (Показать все результаты (>1004) - uneex.lorien.cs.msu.su/ )

• mod_ext_filter - Apache HTTP Server
• HelpOnMoinCommand/ExportDump - UNИX
• mod_actions - Apache HTTP Server

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>34) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

New achievements in Development of Multidimensional Data Acquisition, Processing and Visualization DAQPROVIS M. MorhА *, 1, 2 , V. Matousek 1, 2 1, 3 , J. Kliman 1, 2 , 1 Institute of Physics, Slovak Academy of Sciences, Bratislava, Slovakia 2 Flerov Laboratory of Nuclear Reactions, JINR, Dubna, Russia 3 Laboratory of High Energies, JINR, Dubna, Russia * E-mail: morhac@savba.sk ACAT - 2002 I. Turzo c 1, 3 , . ... The channels are displayed as balls. ... Four-parameter experimental spectrum. ...

Еще в разделе: (Показать все результаты (>69) - acat02.sinp.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>66) - brain.bio.msu.ru/ )

• Unsolved problems and new prospects
• Change-points in EEG components with different pattern

... Now let us consider that damping or amplitude of the signal like a natural index of a hypothetical inequality or mean between the action and reaction, or the kinetic and the potential energy of the system. The time between the action and the reaction must be different from zero. ... We can describe this behaviour in its simpler form by the oscillation of a balance with inertiality or sensitivity, that is to say, with a time of reaction for the operations of adding or removing weights. ...

Еще в разделе: (Показать все результаты (>514) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/shulman_important.pdf
• O.S.Razumovsky. Models of Time in Physics and Cosmology
• Russian Interdisciplinary Temporology Seminar

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements ofљ the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>36) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>160) - www.chem.msu.ru/ )

... The two common precisions single precision (SP) and double precision (DP) on a system based on IEEE 754 can specified with INTEGER , PARAMETER :: SP = SELECTED_ REAL _ KIND (6,37) INTEGER , PARAMETER :: DP = SELECTED_ REAL _ KIND (15,307) REAL ( KIND =SP) :: single_ precision _variables REAL ( KIND =DP) :: double _ precision _variables If we wish to work with at least 14 decimal ...

Еще в разделе: (Показать все результаты (>5954) - crydee.sai.msu.ru/ )

• Tutorial on Fortran 90, Digital UNIX
• Image: Another fine example of typical roof. Still don't know exactly what it
• NAG's Fortran 90

... MAXLEN parameter specifies maximum length of the number considered as a 'good' integer. ... If REJECTLONG = FALSE (default), than dictionary returns prefixed part of integer number with length MAXLEN . ... This is a dict_tmpl.c file. # include postgres.h # include utils/builtins.h # include fmgr.h #ifdef PG_MODULE_MAGIC PG_MODULE_MAGIC; #endif # include utils/ts_locale.h # include utils/ts_public.h # include utils/ts_utils.h typedef struct { int maxlen ; bool rejectlong ; } ...

Еще в разделе: (Показать все результаты (>3324) - www.sai.msu.su/ )

• Zen: sncat design
• CREATE FULLTEXT CONFIGURATION
• The Network Time Protocol (NTP) Distribution