... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>45) - cdfe.sinp.msu.ru/ )

• About CDFE

... Graduated from Moscow State University in 1970 and till now in permanent staff of the Sternberg Astronomical Institute, Moscow State University. ... Member, Euro-Asian Astronomical Society . ... Jointly with Dr. V.Konnikova, I teach a course in Radio Astronomy at the Astronomy Division , Physics Department of Moscow State University . ... Astronomical Meetings . ... Net Search: MetaCrawler . ... Moscow State University . ... Rudnitskij, Georgij M. Page last updated November 25, 2015. th . ...

Еще в разделе: (Показать все результаты (>123) - comet.sai.msu.ru/ )

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>31) - www.anthropos.msu.ru/ )

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>1194) - monkey.belozersky.msu.ru/ )

• Internet Services
• Yeast intein-encoded LAGLIDADG homing endonucleases
• SVETKA, a program for multiple sequence alignments analysus

. Moscow State University Belozersky Institute of Physico-Chemical Biology . English version Russian version . Web-design by Sergei Golyshev .

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

NAME: Iofa Mikhail Zinovievich. ... Examined BRST Ward Identities (WI) in path-integral and operator approaches to string theory and related problems. In the case of the standard conformal gauge, in path-integral approach, on string world sheets of higher genus, by direct calculation the WI were shown to be anomalous, the anomaly being due to noninvariance of the integration domain over the antighosts and auxiliary fields under the BRST transformations. ... iofa@theory.npi.msu.su ...

Еще в разделе: (Показать все результаты (>12892) - theory.sinp.msu.ru/ )

• intas:cern-intas03:task3 [THEP]
• тЬО intas:cern-intas03:task3 [THEP]
• [RU-NGI] Tickets

... annotate . ... allpy/structure: remove Sequence.pdb_residues, add Monomer.pdb_residue Information from aequence.pdb_residues[monomer] is now available in monomer.pdb_residue . ... 1 import sys . bnagaev@83 . ... 3 from allpy.alignment import Alignment . ... 4 from allpy.block import Block . ... 6 p = Alignment ( open ( 'test.fasta' )) . ... 7 print "alignment length: %i " % len ( p ) . ... 8 print "sequence: %s " % str ( p . sequences [ 0 ]) . ... bnagaev@120 . ...

Еще в разделе: (Показать все результаты (>89346) - kodomo.fbb.msu.ru/ )

• allpy: allpy/rna.py annotate
• allpy: allpy/dna.py annotate
• allpy: b92cad794578 test/usecase1.py

Unfortunately, the English version of our site is much less developed than the Russian version. ... Home . ... Copyright ї 2001-2016 Institute for Time Nature Explorations. ... The Institute for Time Nature Explorations web site is established by the Russian Interdisciplinary Temporology Seminar , which has been operating at M. V. Lomonosov's Moscow State University since 1984. ... create an electronic library of works about time; . ... Welcome to the Institute for Time Nature Explorations! ...

Еще в разделе: (Показать все результаты (>450) - chronos.msu.ru/ )

• Status of the Institute
• Russian Interdisciplinary Temporology Seminar
• The Institute for Time Nature Explorations

... Donskikh G., Gorbunova M. Effects of blood plasma inhibitors on the activity of proteases immobilized on dialdehyde cellulose . ... In addition, some preparations with an immobilized proteolytic complex isolated from the crustacean hepatopancreas (CHP) are being developed. ... Moscow University Chemistry Bulletin . 2003, Vol. ... Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>661) - chem.msu.ru/ )

... Data . ... Coronas-Photon . ... Solar energetic particles . ... Nucleon . ... Coronas-Photon (Russian: Коронас-Фотон) or Complex Orbital Observations Near-Earth of Activity of the Sun, is a Russian solar research satellite. ... The goal is to investigate the processes of free energy accumulation in the sun's atmosphere, accelerated particle phenomena and solar flares, and the correlation between solar activity and magnetic storms on Earth. ... protons ( 4 - 80 MeV ) . ... particle energies, MeV . ...

Еще в разделе: (Показать все результаты (>69) - smdc.sinp.msu.ru/ )

• Coronas-I - Space monitoring data center
• Cosmos-1686 - Space monitoring data center

... The department was founded in late sixties by Prof. D.Ya.Martynov, who for many years was also the director of Sternberg Astronomical Institute. At present time, the head of the department is Prof. A.M.Cherepashchuk, a pupil of D.Ya.Martynov and his successor as the director of SAI. Since Prof. Martynov, the scientific activity of the department was primarily related to binary stars. ... The department consists of 15 members most of which have Ph.D. in Astrophysics. ...

Еще в разделе: (Показать все результаты (>19) - uranus.sai.msu.ru/ )

• Katsova Livshits poster paper on CS-11
• Irina Glushneva
• Eugene Trunkovsky

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>28) - seac47-2.phys.msu.ru/ )

... kupry@sai.msu.ru also kupry@asu.cas.cz . ... Solar expeditions. Astronomical Institute Czech Republic Examples IDL procedures Evpatoria Space Image Evpatoria Winter 2012 European Solar Physics Meeting Digital Images Album IDL Lib Karlovy Vary, 2008 List of publications Masha MAX MILLENNIUM PROGRAM My family (new) HSFA-2, 2005 Ondrejov (brezen 2005 ) Ondrejov webcam Photo Ondrejov observatory Praha SatTV Seznam SOHO Solar eclipse 31 July 1981 Software IDL programmes ...

Еще в разделе: (Показать все результаты (>267) - lnfm1.sai.msu.ru/ )

• Server LNFM1
• Maidanak Lab page
• Ekaterina's homepage

. N.N.Bogoliubov Institute for Theoretical Problems of Microphysics . M.V.Lomonosov Moscow State University . Choose encoding: . The URL for ITPM MSU Web Page is http://itpm.msu.su . If you have remarks or suggestions please send your comments to . (C) Copyright ITPM MSU 1997, 1998, 1999

Еще в разделе: (Показать все результаты (>418) - itpm.msu.su/ )

• mod_usertrack - Apache HTTP Server
• mod_status - Apache HTTP Server
• Source and pre-formatted versions available

... F. Rodionova and E. A. Kozlova . ... Sternberg State Astronomical Institute, 119899, Moscow, Russia; jeanna@sai.msu ru. ... Brown University - Vernadsky Institute Microsymposium 34, October 8-9, 2001, Moscow, Russia . ... Brown University - Vernadsky Institute Microsymposium 38, October 27-29, 2003, Moscow, Russia . ... Brown University - Vernadsky Institute Microsymposium 40, 2004, Moscow, Russia . ... 1 Sternberg State Astronomical Institute Lomonosov Moscow University, Russia; marss8@mail.ru . ...

Еще в разделе: (Показать все результаты (>123) - selena.sai.msu.ru/ )

• Родионова Жанна Федоровна
• Шевченко Владислав Владимирович
• Vladislav V. Shevchenko