... Peptide Sequence Databases . ... BLAST searches can be limited to the results of an Entrez query against the database chosen. ... For example: Mus musculus[Organism] For help in constructing Entrez queries please see the " Writing Advanced Search Statements " section of the Entrez Help document. ... Only following combinations of the Matrix, Open & Extended Gaps are available: Recomended combinations are colored. ... Gap . ... Standard BLAST alignment in pairs of query sequence and database match. ...

Еще в разделе: (Показать все результаты (>114) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• BLAST Frequently Asked Questions (FAQ)

... Query= BTUF_ECOLI hypothetical 29.4 kD protein in hemL-pfs intergenic region (265 letters) Database: vc 344 sequences; 4,053,984 total letters Searching.done Score E Sequences producing significant alignments: (bits) Value embl|AE004308|AE004308 Vibrio cholerae O1 biovar eltor str. N169... 168 4e-43 embl|AE004110|AE004110 Vibrio cholerae O1 biovar eltor str. N169... 49 7e-07 embl|AE004301|AE004301 Vibrio cholerae O1 biovar eltor str. ...

Еще в разделе: (Показать все результаты (>5766) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~mashunia/l19201.out
• http://kodomo.cmm.msu.ru/~marine/marina.fasta
• http://kodomo.cmm.msu.ru/~pavel_s/term3/pa_result.txt

... Salmonella typhimurium LT2, section... 147 9e-36 >AE008909 AE006468 |AE008909| ... Sbjct: 9915 aaacataaagtgatcgccagctgctttttcgaagcctc 9878 Database : fg Posted date: Dec 18, 2007 6:08 PM Number of letters in database : 12, 243 ,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 21,910 Number of extensions: 1351 ...

Еще в разделе: (Показать все результаты (>30291) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• allpy: 49d1ba7072a8

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>11885) - mouse.belozersky.msu.ru/ )

Network Working Group Request for Comments: 946 R. Nedved Carnegie-Mellon University May 1985 TELNET TERMINAL LOCATION NUMBER OPTION Status of this Memo This RFC proposes a new option for Telnet for the ARPA-Internet community, and requests discussion and suggestions for improvements. ... Command Name and Option Code TTYLOC 28 2. ... Description of the Option When the user Telnet connects to a remote host, it can send the terminal location number information by doing IAC WILL TTYLOC command. ...

Еще в разделе: (Показать все результаты (>48458) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc946.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1110.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1110.txt

fitshdr_expand - expand/extend FITS-file header fitshdr_expand [options] FITSfile_name . fitshdr_expand utility allows to expand/extend existent FITS headers. FITS MultiExtentionsFiles included). fitshdr_expand is just simple shell script around fitshdr utility. --header-no= NNN . Where NNN - FITS-header's number (0,1,.. ... By default 1. --help . Output a brief help message and exit. --version . Print the version number of fitshdr_expand to standard output and exit. --nobackups . ...

Еще в разделе: (Показать все результаты (>503) - lnfm1.sai.msu.ru/ )

• IDL programs
• Multichannel Flare Spectrograph Archive 1997

Электронная библиотека Попечительского совета . ... Tanigawa Y. - Number Theory: Tradition and Modernization . ... Название: Number Theory: Tradition and Modernization . Автор: Tanigawa Y. Аннотация: . Number Theory: Tradition and Modernization is a collection of survey and research papers on various topics in number theory. ... This book is intended for researchers and graduate students in analytic number theory. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>20915) - lib.mexmat.ru/ )

• Cohn H. - Advanced Number Theory :: Электронная библиотека попечительского
• Farrington C.P., Whitaker H.G. - Estimation of effective reproduction numbers
• Pollard H., Diamond H.G. - The Theory of Algebraic Numbers :: Электронная

... Instructions are in README.TXT file inside the tarball. ... tar -xvf nhunt_x86.tar Query and database files should contain sequences in FASTA format ( wikipedia description ). ... Default name of the output file is 'nhunt.out'. ... Any parameter consists of key and value and is called as '-key value', where 'key' is one character and 'value' is any number of characters. -i Query file . ... No default value. -d Database file . ... No default value. -o Output file . ... Default value: 'nhunt.out' . ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

Maximum RPM: Taking the Red Hat Package Manager to the Limit . ... the section called The Package Label ? Verify an Installed Package Against the RPM Database . ... Verify the Package Owning <file> Against the RPM Database . ... Verify all installed packages . ... Verify All Installed Packages Against the RPM Database . ... Verify packages belonging to group <group> . ... It would be handy if RPM did nothing more than verify that every file installed by a package actually exists on your system. ...

Еще в разделе: (Показать все результаты (>2032) - uneex.lorien.cs.msu.su/ )

• DVARP
• DSTDEVP
• DCOUNT

... Previous message: [RU-NGI] Fwd: NOTIFICATION on GGUS-Ticket-ID: # 114235 "ASSIGNED" "ROC_Russia" "Region not publishing accounting by number of cores." Next message: [RU-NGI] Fwd: NOTIFICATION on GGUS-Ticket-ID: # 114235 "ASSIGNED" "ROC_Russia" "Region not publishing accounting by number of cores." ... REFERENCE LINK: >> https://ggus.eu/index.php?mode=ticket_info&ticket_id=114235 >> SUBJECT: Region not publishing accounting by number of cores. ...

Еще в разделе: (Показать все результаты (>2148) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: NOTIFICATION on GGUS-Ticket-ID: # 114235 "ASSIGNED" "ROC_Russia"
• [RU-NGI] Fwd: You have been assigned Ticket #2895

PHP Manual . Prev . Next . 3.0.11 - 3.0.18 only, PHP 4 >= 4.0.0) dbase_replace_record -- Replace a record in a dBase database . bool dbase_replace_record ( int dbase_identifier, array record, int dbase_record_number) . Replaces the data associated with the record record_number with the data in the record in the database. ... dbase_add_record . ... dbase_delete_record ...

Еще в разделе: (Показать все результаты (>2942) - oit.cmc.msu.ru/ )

• GMP functions
• dbase_numfields
• dbase_numrecords

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>113) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - NEW MP2 GRADIENT CODE
• Firefly v. 8.0.0 documentation - numerical gradients
• PC GAMESS/Firefly DOCUMENTATION - TDHF

... Above, we already encountered LCP, the Link Control Protocol, which is used to negotiate link characteristics, and to test the link. The two most important options that may be negotiated by LCP are the maximum receive unit, and the Asynchronous Control Character Map. ... The Asynchronous Control Character Map, colloquially called the async map, is used on asynchronous links such as telephone lines to identify control characters that must be escaped (replaced by a specific two-character sequence). ...

Еще в разделе: (Показать все результаты (>571) - itpm.msu.su/ )

• Creating a user
• Using Options Files
• Miscellaneous config Options

A simple stack-based parser that parses infix expressions with nonary, unary and binary operators specified using an operator table. ... Creates a new infix parser. ... The tokeniser matches tokens in the following order: operators, quotes (" and '), numbers, words, brackets. ... name - operator string . ... The existance of close marks this as a bracket operator. casematters= - indicates that the parser should check case in the operator name (i.e. treat 'AND' and 'and' as different). ...

Еще в разделе: (Показать все результаты (>40647) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (1 vs. 2) - TWiki
• TWikiInfixParserDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... CENTRE FOR PHOTONUCLEAR EXPERIMENTS DATA . Online Services | ... ONLINE SERVICES. ... G E N P D T H3 A HE3 HE4 LI6 C12 O16 O17 O18 S32 AR40 TI48 BRST BRST-POL MON MON-POL POL . ... CDFE Head : Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>4949) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE => Online Services => Nuclear Reaction Threshold and Energy Values

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• COSRAD model - Space monitoring data center
• AP8/AE8 model - Space monitoring data center
• ShielDose2 model - Space monitoring data center

... О UNИX . ... Неизменяемая страница . ... Processing Instructions . ... redirect . ... pragma . ... deprecated . ... MoinMoin processing instructions have the same semantics as in XML: they control the paths taken when processing a page. ... For more information on the possible markup, see HelpOnEditing . Processing instructions MoinMoin knows of: . ... Redirect to a different page (see PageRedirect ) #REDIRECT pagename . ... Sets processing modes for this page: #PRAGMA mode arguments . ...

Еще в разделе: (Показать все результаты (>1240) - uneex.mithril.cs.msu.su/ )

• Index of /static/AltDocs_informatika2/Book2/ch_10_prolog/11_number_task

To set a number of options place the set commands in the file .exrc . set ic set number set sh=/usr/local/bin/Tcsh set wm=5 . This sets vi to: . ignore the case of characters in searches . display line numbers . use the TC shell to execute UNIX commands . ... Options can also be set using the environment variable EXINIT. setenv EXINIT 'set ic number sh=/usr/local/bin/Tcsh wm=5' . For the C and TC shell user, this sets the same options as in the example above. ...

Еще в разделе: (Показать все результаты (>331) - comet.sai.msu.ru/ )

• Examples of setting vi options temporarily
• Useful vi options
• Options that can be used to change the sort order

Detection of short size mutations and copy number alterations in ultra-deep targeted sequencing data Valentina Boeva, Emmanuel Barillot, Institut Curie, valentina.boeva@curie.fr Jean-Francois Laes OncoDNA, jf.laes@oncodna.com The emergence of the amplicon sequencing technique, which followed whole exome sequencing, promises a revolution in cancer diagnostics and treatment. ... Visualization of the typical configuration of read mappings (with Integrative Genomics Viewer). ...

Еще в разделе: (Показать все результаты (>325) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/160.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/99.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/209.pdf

Laboratory for the Study of Byzantium and the Black Sea Region . ... By order of the Rector of Moscow State University, the laboratory was assigned the task of coordinating all research in the areas of Byzantine studies and the history of the Black Sea Region during the middle centuries. ... Included among the staff of the laboratory are a number of highly qualified scholars of the middle centuries, Byzantium, Eastern studies, and information science. ...

Еще в разделе: (Показать все результаты (>203) - hist.msu.ru/ )

• Labour recruiting policy and the Nobel Association of Oil Producers. A Set of