Assessment of applicability of the program Rosetta for the determination of membrane associated proteins structure. M1 influenza virus protein E.N. BOGACHEVA*, A.L. KSENOFONTOV**, A.V. SHISHKOV* N.N. Semenov Institute of Chemical Physics Russian Academy o f Sciences, ul. ... We analyzed the structure of the M1 protein of the influenza virus A/Puerto Rico/8/34 (H1N1) strain in acidic solution using tritium planigraphy [2, 3]. ...

Еще в разделе: (Показать все результаты (>253) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/156.pdf

... Sergey V. Borisov . ... Kaplan A.Ya ., Borisov S.V. , Zheligovsky V.A. Classification of EEG's of adolescents based on spectral and segment parameters for the purposes of schizophrenia diagnostics // Biological Psychiatry, 2005 (ISSN 0006-3223), submitted . Borisov S.V. , Kaplan A.Ya ., Gorbachevskaya N.L., Kozlova I.A. Structural organization of the EEG alpha activity in adolescents with schizophrenic spectrum disorders // Zh . ... Borisov S.V. , Gorbachevskaya N.L., Kaplan A.Ya . ...

Еще в разделе: (Показать все результаты (>72) - brain.bio.msu.ru/ )

... This form lets you to produce a list of hydrophobic clusters in a PDB file specified by user. Enter a 4-letter PDB code, e.g.: 1apl : . Search clusters: . ... between chains . Contacts between chains . Set #1 . ... Enter your e-mail here (optional): . ... List of atoms Strict Wide . Chains filter (1-20:A) . Show clusters not smaller than atoms . User data file in PDB format . ...

Еще в разделе: (Показать все результаты (>5490) - monkey.belozersky.msu.ru/ )

... Nonlinear Sound Wave Propagation in 2-D Hysteretic Medium . ... Numerous experimental and theoretical researches show hysteresis of mesoscale structures essentially changes nonlinear properties of the media. ... Computer simulation of finite amplitude sound wave propagation in 2-D medium with random mesoscale hysteresis has been done. It is shown that hysteresis process leads to 2-D fractal formation in the medium structure under cyclic sound excitation. ...

Еще в разделе: (Показать все результаты (>526) - acs366.phys.msu.su/ )

• Abstract (Invited)

Head of the division - Professor Yuri A. ZOLOTOV . Founded in 1929, it developed from the laboratory of organic and analytical chemistry of the Faculty of Physics and Mathematics, functioning since 1929. Heads of the Department (since 1929): Professor A. Y. Uspensky (1929-1930); Professor Y. S. Przhevalsky (1930-1953), Academician I. P. Alimarin (1953-1989). ... Spectroscopic methods of analysis . ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>1743) - chem.msu.ru/ )

• Laboratory of Crystal Chemistry, Chemistry Department, Moscow State University
• Laboratory of Nuclear Chemistry Techniques
• Leonid V. Serebrennikov

This home page belongs to small group of scientists working at . Sternberg Astronomical Institute which is a part of Moscow State University . ... Электронная библиотека научно-технической и художественной литературы (доступна только из ГАИШ) . ... Local staff . Dr. Edward Kononovich (konon -at- sai.msu.ru), Associate Professor . ... Dr. Sergey Ayukov (asv -at- sai.msu.ru), Research Fellow, Webmaster of the group . ... Joint seminar of Solar Studies Structure Group and Solar Photometry Group . ...

Еще в разделе: (Показать все результаты (>1467) - crydee.sai.msu.ru/ )

• V.A.Baturin - Home Page at Sternberg Astronomy Institute, MSU

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>225) - www.genebee.msu.ru/ )

• INTAS :: Global and Local Protein Matching
• Screening pattern or alignmemt against PROTEIN databank
• GEA :: Gene Expression Analysis

... Optimal structure of a distributed grid metasheduler" . Semenov D.V., Korneev V.V. An approach to choosing a tree-like structure of a metasheduler is considered to provide the grid resource allocation of a given job stream. Keywords: grid, distributed task allocation, hierarchical tree-like structure of grid metasheduler . PostScript (in Russian) (4.92MB) . PDF (in Russian) (227KB) . ... Semenov D.V. e-mail: sdvbox@gmail.com ; Korneev V.V. e-mail: korv@rdi-kvant.ru ...

Еще в разделе: (Показать все результаты (>1184) - num-meth.srcc.msu.ru/ )

• A system for analysis of information structure of programs.
• Adaptive unstructured mesh generation methods for hydrogeological problems
• "Data structuring and formalization in the hybrid database on molecular

Web-site : http://polly.phys.msu.su/seminar/vms/ 23 2002 . ... 1 2002 . ... Deadline for submission of abstracts Web-site: http://liquid.chem.uoa.gr International conference on: Colloid and Surface Technology; Fundamentals and Applications Lund, Sweden November 6th to 8th 2002. ... February 2003, Zurich, Switzerland Deadlines Abstract submission Camera ready manuscript May 31, 2002 October 31, 2002 Web-site: http://www.isfrs.ethz.ch " " 90- . ... Web site: http://www.icp.ac.ru/conference/EKS/ : - ., ...

Еще в разделе: (Показать все результаты (>650) - polly.phys.msu.ru/ )

• http://poly.phys.msu.ru/ru/seminar/vms/25092001/seminar250901.pdf
• http://polly.phys.msu.ru/~shaytan/abstract.pdf
• http://poly.phys.msu.ru/ru/seminar/vms/22052001/info220501.pdf

... Menzerath's Law for Morphemic Structures of Words: . A Hypothesis for the Evolutionary Mechanism of its Arising and its Testing . Anatoliy A. Polikarpov . ... Key words: Menzerath's Law, morphemic structures, language evolution . ... In this paper there is present (1) a hypothesis for understanding the evolutionary mechanism responsible for the Law arising and (2) some data for testing the hypothesis. ... A Hypothesis. ... Altmann, G. Prolegomena to Menzerath's Law//Glottmetrika 2. ...

Еще в разделе: (Показать все результаты (>87) - old.philol.msu.ru/ )

Singularly p erturb ed problems with b oundary and internal layers Adelaida B. Vasilieva Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: ABVAS@phys.msu.ru Valentin F. Butuzov Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: butuzov@phys.msu.ru Nikolay N. Nefedov Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: nefedov@phys.msu.ru Nonlinear singularly ...

Еще в разделе: (Показать все результаты (>58) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gaifullin.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/KolesovMishchenkoRozov.pdf

Электронная библиотека Попечительского совета . ... Chaffey D. - Total E-Mail Marketing . ... Название: Total E-Mail Marketing . Автор: Chaffey D. Аннотация: . Total E-Mail Marketing shows how to run effective e-mail campaigns aimed at both customer acquisition and retention. ... Dave Chaffey has written many articles and books on e-marketing and is a columnist for the What's New in Marketing E-newsletter. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>12047) - lib.mexmat.ru/ )

• Peters C.A., Steenbrink J.H. - Mixed Hodge Structures :: Электронная библиотека
• Eisenberg D., Kauzmann W. - The Structure and Properties of Water ::
• Antonov V., Harmon B., Yaresko A. - Electronic structure and magneto-optical

... О физическом факультете . ... Помощь факультету . ... Лицензионное матобеспечение Microsoft . ... Главная / О факультете / Подразделения факультета / Научные центры / Лицензионные пакеты Microsoft . Мы рады сообщить Вам, что в настоящее время на физическом факультете МГУ решен вопрос с лицезированным программным обеспечением фирмы Микрософт (за исключением пакета программ Microsoft Office) для обеспечения учебного и научного процессов. ... Информация о MSDN Academic Alliance фирмы Микрософт . ...

Еще в разделе: (Показать все результаты (>4416) - phys.msu.ru/ )

• Как получить копию лицензионного пакета LabView для использования в
• Faculty of Physics
• DIVISIONS AND CHAIRS

.

Еще в разделе: (Показать все результаты (>282) - lnfm1.sai.msu.ru/ )

• Anatoly V. Zasov
• Yuri Nicolaevich Efremov - My Home Page
• Список участников

... Prof, head of the laboratory of x-ray diffraction and crystal chemistry Home address: Russia, 115470, Prosp. ... 1964-1969 a student of Geological faculty MSU, department of crystallography 1969-1973 a post graduate student (scientific advisor academician N.V.Belov) 1974 Ph.D., speciality 'Crystallography and Crystalphysica', title of Ph.D. Thesis 'Crystal structures of (Na,Cd)-germanates' 1994 D.Sc., speciality 'Physical chemistry', title of D.Sc. ... E.L.Belokoneva, L.I.Leonjuk, V.S.Urusov. ...

Еще в разделе: (Показать все результаты (>64) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/en/
• http://cryst.geol.msu.ru/staff/yakubovich.php

... Inorganic Materials Sciences . ... Development of well defined inorganic materials for chemical and physical sensors on the base of complexe oxides, vanadates and phosphates. ... The laboratory staff carries out fundamental research on gas sensors on the base of SnO2; chemistry and technology of scandium; chemistry of complex oxides of zirconium, hafnium and rare-earth elements; chemistry of complex phosphates, vanadates, arsenates and tellurates of rare earths, gallium and scandium. ...

Еще в разделе: (Показать все результаты (>187) - www.inorg.chem.msu.ru/ )

• Сотрудники - Лаборатория Химии Координационных Cоединений
• Synthesis, Crystal and Electronic Structure of Subvalent Metal Compounds
• Petr S. Berdonosov

E-mail: lmis@miem.edu.ru The distribution of electromagnetic field in sheet materials placed in microwave devices based on one-dimensional periodic slow-wave structures are investigated. The influence of width and period variation of slow-wave structures on the distribution of temperature field are also investigated. ... 1. - 1 ґ , 2 ґ , 3 ґ , 4 ґ , 5 ґ , 6 ґ , 7 ґ , l ґ , v ґ Ansoft HFSS. ... HFSS . ... 1970, . ... 1998. ... VIII ? , , ?, 19ґ20 2007 . ...

Еще в разделе: (Показать все результаты (>269) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/school/s09/09_26.pdf
• http://nuclphys.sinp.msu.ru/school/s09/09_17.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_28.pdf

... Ферсман А.Е. "Кристаллография алмаза" . С вопросами кристаллизации и происхождения алмаза связаны проблемы исключительного интереса и важности.. ... Стенон Н. "О твердом, естественно содержащемся в твердом" . ... Гаюи Р.Ж. "Структура кристаллов (избранные труды)" . ... Его смелая гипотеза о перемещении континентов имела большое значение для дальнейшего развития геологии. ... Обручев В.А. "Образование гор и рудных месторождений" . ... Леммлейн Г.Г. "Морфология и генезис кристаллов" . ...

Еще в разделе: (Показать все результаты (>4058) - geo.web.ru/ )

... The article examines the role of civil society institutes in the system of interaction of subjects of economic development. ... The impact of certain civil society institutes on general economic development is determined based on the author s multi-factor econometric model. The author s research gives substance to the recommendations on the formation of civil society institutes in national economic systems, which will benefit their economic development. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>570) - ee-journal.spa.msu.ru/ )

Q ґ .., .., .., .. , ?? , 141980, . 19 .: (49621) 2-24-78, e-mail: gadjiev@uni-dubna.ru , , [1]. , , q-. , [2] , q- , q 1 , . ... 510 3 , . ... Pastor-Satorras R., Vespignani A. Evolution and Structure of the Internet: A Statistical Physics Approach. Cambridge: Cambridge University Press, 2004. 267 . ... J. Phys. 29, 1999. P. 1-35. ...

Еще в разделе: (Показать все результаты (>207) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc177422/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc151432/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc150572/eng.pdf