... The LanHEP input file is the sequence of statements, each starts with a special identifier (such as parameter, lterm etc) and ends with the full-stop ' . ... This section is aimed to clarify the syntax of LanHEP input files, i.e. the structure of the statements. ... Let us consider the LanHEP input files for the Standard Model with both the t'Hooft-Feynman and unitary gauges. ... LanHEP allows the user to define several keys , and use these keys to branch among several variants of the model. ...

Еще в разделе: (Показать все результаты (>1549) - theory.sinp.msu.ru/ )

... education . research . ... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>46) - nano.msu.ru/ )

Additional topic data, program-generated or from TWikiForms , is stored embedded in the topic text using META: tags . ... Meta Data Syntax . Meta Data Specifications . ... META:FORM . ... By default, TWiki stores topics in files on disk, in a really simple and obvious directory structure. ... Order of fields within the meta variables is not defined, except that if there is a field with key name , this appears first for easier searching (note the order of the variables themselves is defined). ...

Еще в разделе: (Показать все результаты (>41671) - dualopt1.cmm.msu.ru/ )

Full-Text Search in PostgreSQL: A Gentle Introduction . ... COMMENT ON FULLTEXT -- define or change the comment of a full-text object . COMMENT ON FULLTEXT { CONFIGURATION | ... COMMENT ON FULLTEXT stores a comment about a full-text object (configuration, dictionary, parser). To modify a comment, issue a new COMMENT ON FULLTEXT command for the same full-text object. ... COMMENT ON FULLTEXT DICTIONARY intdict IS 'Dictionary for integers'; =# \dFd+ intdict List of fulltext dictionaries Schema | ...

Еще в разделе: (Показать все результаты (>5834) - www.sai.msu.su/ )

• SAL- Numerical Analysis - Discrete Methods Related Tools - Analysis Tool for
• SAL- Office Software - Typesetting Formating - Xy-pic
• SAL- Other Scientific Fields - Artificial Intelligence - Hdrug

О лаборатории . ... Лаборатория теоретической биофизики . ... Download script: memgen-0.0.1.tar.gz System requirements: python 2 (2.6 and higher), python openbabel library, python numpy library. ... continue reading..... ab initio basis sets cp2k education Firefly FRAP GAMESS gromacs MDAnalysis membrane mmb nano OPLS pymol python scipy sparse matrix toolset topology познавательно учебные материалы . OPLS-AA patch for different types of molecules . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>45) - erg.biophys.msu.ru/ )

• python ERG Research Group: Лаборатория теоретической биофизики
• cp2k ERG Research Group: Лаборатория теоретической биофизики
• gromacs ERG Research Group: Лаборатория теоретической биофизики

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>244) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank

PHP Manual . ... Next . PHP supports 'C', 'C++' and Unix shell-style comments. ... php echo "This is a test"; // This is a one-line c++ style comment /* This is a multi line comment yet another line of comment */ echo "This is yet another test"; echo "One Final Test"; # This is shell-style style comment ?> ... You should be careful not to nest 'C' style comments, which can happen when commenting out large blocks. <?php /* echo "This is a test"; /* This comment will cause a problem */ */ ?> ...

Еще в разделе: (Показать все результаты (>941) - oit.cmc.msu.ru/ )

• LDAP functions
• Alternative syntax for control structures
• wddx_packet_start

... J. Clark December 1995 Message/External-Body Content-ID Access Type Status of this Memo This memo defines an community. ... An encapsulation normally maps each of the structured objects elements to a MIME entity. ... The existing MIME Content-Type Message/External-Body allow a MIME entity (body-part) to refer to an object the message by specifying how to access that object. access method described in this document provides the refer to an object within the message. ...

Еще в разделе: (Показать все результаты (>22092) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5612.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5612.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc448.txt

Top comment output 2 -- ProjectContributor - 26 Nov 2006 . ... Default comment output 1 -- ProjectContributor - 26 Nov 2006 . ... Above comment output 1 -- ProjectContributor - 26 Nov 2006 . ... Below comment output 2 -- ProjectContributor - 26 Nov 2006 . ... Threadmode comment output 1 -- ProjectContributor - 26 Nov 2006 . ... After comment output 1 -- ProjectContributor - 26 Nov 2006 . ... Bottom comment output 1 -- ProjectContributor - 26 Nov 2006 . ... This topic: Sandbox > CommentPluginExamples . ...

Еще в разделе: (Показать все результаты (>7224) - wiki.cmc.msu.ru/ )

• TipTopic024 < System < Foswiki

These are the contents of a shell script called display : cat display # This script displays the date, time, username and # current directory. echo "Date and time is:" date echo echo "Your username is: `whoami` \\n" echo "Your current directory is: \\c" pwd . The first two lines beginning with a hash ( # ) are comments and are not interpreted by the shell. Use comments to document your shell script; you will be surprised how easy it is to forget what your own programs do! ...

Еще в разделе: (Показать все результаты (>517) - comet.sai.msu.ru/ )

• Hypertext Markup Language - 2.0 - Table of Contents
• Understanding HTML and SGML
• The Structure of HTML 3.0 Documents

Электронная библиотека Попечительского совета . ... Kim G.J. - Building Virtual Reality Systems: The Structured Approach . ... Название: Building Virtual Reality Systems: The Structured Approach . Автор: Kim G.J. Аннотация: . ... Much more hands-on than other introductory books, concrete examples practical solutions to the technical challenges in building a VR system are provided. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>17500) - lib.mexmat.ru/ )

• Поиск книг, содержащих Comments :: Электронная библиотека попечительского
• Cherubini U., Della Lunga G. - Structured Finance: The Object-Oriented Approach
• Olsson M.-O., Sjostedt G. - Systems Approaches and Their Application: Examples

This home page belongs to small group of scientists working at . Sternberg Astronomical Institute which is a part of Moscow State University . ... Электронная библиотека научно-технической и художественной литературы (доступна только из ГАИШ) . ... Local staff . Dr. Edward Kononovich (konon -at- sai.msu.ru), Associate Professor . ... Dr. Sergey Ayukov (asv -at- sai.msu.ru), Research Fellow, Webmaster of the group . ... Joint seminar of Solar Studies Structure Group and Solar Photometry Group . ...

Еще в разделе: (Показать все результаты (>2392) - crydee.sai.msu.ru/ )

• Dynamic HTML in Communicator
• About the HTML 4.0 Specification
• A Simple Example With a Single Chirp Component

... The normal directory layout consists of a single top-level directory (The default name is /usr/src/redhat ), with five subdirectories. ... Contains the binary package files created by the build process. /usr/src/redhat/SRPMS ? ... ls -lF /usr/src/redhat total 5 drwxr-xr-x 3 root root 1024 Aug 5 13:12 BUILD/ drwxr-xr-x 3 root root 1024 Jul 17 17:51 RPMS/ drwxr-xr-x 4 root root 1024 Aug 4 22:31 SOURCES/ drwxr-xr-x 2 root root 1024 Aug 5 13:12 SPECS/ drwxr-xr-x 2 root root 1024 Aug 4 22:28 SRPMS/ # . ...

Еще в разделе: (Показать все результаты (>858) - uneex.lorien.cs.msu.su/ )

• HelpOnPackageInstaller - UNИX
• Platform-Dependent Conditionals
• Creating the Spec File

... Statistics One, Lecture 3, example script # Read data, plots histograms, get descriptives library("psych") ratings . Statistics One, Assignment One Statistics 1, Assignment 2 . ... Дайджест психологических исследований . ЖЖ-сообщество ?RU_SPSS? ... Сервер виртуальных исследований . Скачать SPSS . Статистика блога . ... R-советы: Экономим время и место на диске путем сжатия файла данных . ... Yurij Tukachev on Twitter Counter Вам нравятся материалы блога? ...

Еще в разделе: (Показать все результаты (>169) - tukachev.flogiston.ru/ )

• Category: Новости
• Statistics One, Assignment One
• Statistics 1, Assignment 2

... Comments Example comment topic for CommentPluginExamples "return" Target comment output 1 Main.ProjectContributor 03 Dec 2006 Target comment output 2 Main .. NEW - 27 May 2010 - 20:28 by ProjectContributor . ... NEW - 08 Feb 2009 - 04:38 by ProjectContributor . ... GenPDFAddOn Child Topic Header Level 2 This is a First level child below the PDF Demo topic. ... NEW - 06 Jan 2010 - 21:11 by ProjectContributor . ... Foswiki's Sandbox web . NEW - 13 Aug 2010 - 02:06 by ProjectContributor . ...

Еще в разделе: (Показать все результаты (>2202) - wiki.cs.msu.ru/ )

• (backlinks in Sandbox Web) CommentPluginExamples < Sandbox < Foswiki
• WebChanges < Sandbox < Foswiki

The essence of VES data processing may be shown on a flexure fold model (The central part of model is shown on fig.6). 2D modeling data for the flexure fold added with NSI were processed with the IPI-2D package, but at first example deep objects resistivities were made equal to surrounding to neglect their influence. ... Full model of flexure fold with NSI and deep objects . ... Comparison of apparent resistivity fields after filtering (a) and calculated without NSI (b) . ...

Еще в разделе: (Показать все результаты (>105) - geophys.geol.msu.ru/ )

• TRF_2d. Page 3.
• TES. Field example.
• TES tecnology. MSU.

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>23) - mouse.belozersky.msu.ru/ )

• wLake program homepage
• Example of alignment
• 1QPI biounits

. A program for alignment of structures of DNA-protein complexes . Home . Feedback . Help . About . Input PDB code of the first complex: and chain of the protein (optional): . Input PDB code of the second complex: and chain of the protein (optional): . If you get stuck with program input, try example data and click Align! Example data . 2016

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• ConClus

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>71) - www.intsys.msu.ru/ )

... An Application Example . Up: Process Topologies Next: MPI Environmental Management Previous: Low-level topology functions . The example in figure An Application Example shows how the grid definition and inquiry functions can be used in an application program. ... In each relaxation step each process computes new values for the solution grid function at all points owned by the process. Then the values at inter-process boundaries have to be exchanged with neighboring processes. ... Центры . ...

Еще в разделе: (Показать все результаты (>460) - www.parallel.ru/ )

• MPI: A Message-Passing Interface Standard | PARALLEL.RU -
• Examples | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по