Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>215) - comet.sai.msu.ru/ )

• Filename completion with the C shell
• Filename completion with the TC shell
• Filename completion with the Bourne Again SHell

... Communication Completion . ... MPI_REQUEST_NULL. ... A empty status is a status which is set to return tag = MPI_ANY_TAG, source = MPI_ANY_SOURCE, and is also internally configured so that calls to MPI_GET_COUNT and MPI_GET_ELEMENTS return count = 0. ... INTEGER REQUEST, STATUS(MPI_STATUS_SIZE), IERROR . ... Once a request is freed by a call to MPI_REQUEST_FREE, it is not possible to check for the successful completion of the associated communication with calls to MPI_WAIT or MPI_TEST. ... Центры . ...

Еще в разделе: (Показать все результаты (>1248) - www.parallel.ru/ )

• MPI_Waitsome | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Waitany | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Test | PARALLEL.RU - Информационно-аналитический центр по параллельным

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>91) - graphics.cs.msu.ru/ )

• Detection of multiple object instances using Hough transform | Graphics and
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>88) - hist.msu.ru/ )

Title: bash-completion-2.1-r90 Author: Michaе? GцЕrny <mgorny@gentoo.org> Content-Type: text/plain Posted: 2014-11-25 Revision: 1 News-Item-Format: 1.0 Display-If-Installed: >=app-shells/bash-completion-2.1-r90 Starting with app-shells/bash-completion-2.1-r90, the framework used to enable and manage completions in Gentoo is finally changing in order to properly follow upstream design. ... Firstly, the install location for completions changes to follow upstream default. ...

Еще в разделе: (Показать все результаты (>19031) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc269.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc269.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc2062.txt.pdf

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>65) - angel.cs.msu.su/ )

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>4760) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Palace Located In Pattaya

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>2177) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/n/new.order/movement.1
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/m-o/mydoom2.txt

Электронная библиотека Попечительского совета . ... Mikesh R.C. - Martin B-57 Canberra: The Complete Record . ... Название: Martin B-57 Canberra: The Complete Record . ... No story about one type of aircraft could be more complete than this coverage about the B-57 Canberra. ... Robert C. Mikesh had accumulated 2,000 hours in flying the B-57 Canberra, beginning with the first USAF unit to receive the bomber version. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>10355) - lib.mexmat.ru/ )

• Erickson M. H. - Complete Works. Initial Experiments Investigating the Nature
• McConnell S. - Code Complete :: Электронная библиотека попечительского совета
• Purcell J. - Linux Complete Command Reference :: Электронная библиотека

... PHP 3 <= 3.0.18, PHP 4 >= 4.0.0) ldap_get_attributes -- Get attributes from a search result entry . ... return_value[0] = first attribute . ... ds is the link identifier for the directory // $sr is a valid search result from a prior call to // one of the ldap directory search calls $entry = ldap_first_entry($ds, $sr); $attrs = ldap_get_attributes($ds, $entry); echo $attrs["count"]." attributes held for this entry:<p>"; for ($i=0; $i<$attrs["count"]; $i++) echo $attrs[$i]."<br>"; . ...

Еще в разделе: (Показать все результаты (>977) - oit.cmc.msu.ru/ )

• How Directory, Location and Files sections work
• ccvs_void
• readline_completion_function

The sections <Directory> , <Location> and <Files> can contain directives which only apply to specified directories, URLs or files respectively. Also htaccess files can be used inside a directory to apply directives to that directory. ... The order of merging is: . ... If multiple <Directory> sections apply to the same directory they are processed in the configuration file order. ... Using the options in question is only possible inside a <Directory> section (or a .htaccess file). ...

Еще в разделе: (Показать все результаты (>105) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Server-Wide Configuration
• Apache module mod_isapi

Registration completed on this website places you onto the symposium participants list. ... You must confirm your participation in the symposium at the registration desk located in the lobby of "Small Biological Auditorium MI" (Malaya Biologicheskaya) on the second floor of the south wing of the Biological Faculty building. ... Please clearly display your badge while you are inside of the building. ... If you plan to attend, please fill out respective line in the registration form. ...

Еще в разделе: (Показать все результаты (>119) - www.genebee.msu.ru/ )

GRS . GRS is a graphic tool for retrieval and visualization of genome segments from partially or completely sequenced genomes. To facilitate visual identification of conserved genomic motifs, genes are color-coded according to their presumed functional roles. ... The gene string analysis option of GRS allows the identification of genes that are identically arranged in any pairwise set of genomes. ... None . ... SAL Home | Other Scientific Fields | Chemistry, Biology Related . ...

Еще в разделе: (Показать все результаты (>2914) - www.sai.msu.su/ )

• APOD: September 30, 1997 - Half Dome Rock on Mars
• APOD: April 2, 1997 - A Complete Aurora
• APOD: 2007 December 3 - A Complete Solar Cycle from SOHO

ENA|AE008691|AE008691.1 Thermoanaerobacter tengcongensis MB4, complete genome. Location:53858.. 55384 --------GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAACACATGC AAGTCGAGC -----GGGC----------CTGTCAAGGCG-TTATGTTTT----------- ---GGCAGGTTAAGCGGCGGACGGGTGAGTAACGCGTGAGCAACCTACCCTTGAGACAGG GATAACCCTGGGAAACCGGGGCTAATACCTGATATACTCTATTAGGGCATCCTGATGGAG Location:18125.. ... Location:35825.. ... Location:116896.. ... Location:529146.. ... Location:105734.. ... W23, complete genome. ...

Еще в разделе: (Показать все результаты (>2040) - kodomo.cmm.msu.ru/ )

• Учебный сайт Дуванова Дмитрия
• Changeset 20:eef739e055f4 тАУ Cyclyc Cell Automata
• Result summary blast-20091031-1941229237

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>51) - classic.chem.msu.su/ )

... Four Seasons" song from the film "The wandering songstress" . ... Wayfoong House, completed in 1928. Sizhou zhong lu 220. The Holy Trinity Anglican Church (1866) and Cathedral school (1928) are located on JiuJian lu 219. ... Old church at LaoBeiMen . Old Shanghai Fire Station built in 1911, HuaiHai Zhong lu 193-3 . The building near old fire station on Baochang Road Huaihai Zhong Lu lukou. ... 1897 Huaihai Zhong lu. ... Building reconstructed near the Shanghai Film Museum . ...

Еще в разделе: (Показать все результаты (>137) - lnfm1.sai.msu.ru/ )

My colleagues and I have recently completed a series of observations of SN1999an. ... The telescope is located at Martin Observatory in Blacksburg, VA, and is operated by the Physics Department of Virginia Tech. Our IAU Minor Planet Center Observatory Code is 841. ... Attached you will find a copy of one of our images (in .jpg format) with the supernova indicated. ... Virginia Tech Department of Physics . Back to Bright Supernovae . Back to Supernova 1999an . ...

Еще в разделе: (Показать все результаты (>39) - www.rochesterastronomy.org/ )

... help . find changesets by author, revision, files, or words in the commit message . ... files . ... 1.1 --- /dev/null Thu Jan 01 00:00:00 1970 +0000 1.2 +++ b/geometrical_ core /geometrical_ core .py Sun Oct 24 16:30:44 2010 +0400 1.3 @@ -0,0 +1,40 @@ 1.4 + 1.5 +Geometrical Core building tool 1.6 +version 2.0 1.7 + 1.8 + 1.9 +from allpy .lib import config, project, block 1.10 +Block = block.Block 1.11 +Project = project.Project 1.12 +import argparse 1.13 + 1.14 +r ...

Еще в разделе: (Показать все результаты (>14638) - kodomo.fbb.msu.ru/ )

• allpy: log
• cca: eef739e055f4

The sections <Directory> , <Location> and <Files> can contain directives which only apply to specified directories, URLs or files respectively. Also htaccess files can be used inside a directory to apply directives to that directory. ... The order of merging is: . ... If multiple <Directory> sections apply to the same directory they they are processed in the configuration file order. ... Using the options in question is only possible inside a <Directory> section (or a .htaccess file). ...

Еще в разделе: (Показать все результаты (>665) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - application/application.cpp example file
• Apache HOWTO documentation
• Linux Threads Home Page: Is the kernel 100% reentrant?

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>777) - theory.sinp.msu.ru/ )

• spamassassin - extensible email filter used to identify spam
• [RU-NGI] Fwd: CERN CA Website IP change
• rfbr:rest:jobschema [THEP]