CodeBase . CodeBase 6 is a high-speed, xBASE compatible database engine for C/C++ programmers. ... With CodeBase you can create applications (up to 64-bit) that are single and multi-user file compatible with FoxPro, dBASE and Clipper. ... Add-ons for Java, SQL, OLE DB/ADO and ODBC are also available. CodeBase versions are also available for most development languages as well as most operating systems. ... http://www.sequiter.com . ... SAL Home | ... Utilities Other DBMS . ...

Еще в разделе: (Показать все результаты (>5106) - www.sai.msu.su/ )

• SAL- Database Systems - Utilities Other DBMS - QuickList
• SAL- Programming - Tools & Utilities - Jylu
• SAL- Database Systems - Utilities Other DBMS - FlagShip

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4933) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

Электронная библиотека Попечительского совета . ... Mullins C.S. - Database Administration: The Complete Guide to Practices and Procedures . ... Название: Database Administration: The Complete Guide to Practices and Procedures . ... With Database Administration, database professionals now have a comprehensive sourcebook of strategies for delivering quality administration across today's challenging multi-DBMS environments. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>15322) - lib.mexmat.ru/ )

• Loney K. - Oracle Database 10g: The Complete Reference :: Электронная
• Brown M.C. - Perl: The Complete Reference :: Электронная библиотека
• Loney K., Koch G. - Oracle8i: The Complete Reference :: Электронная библиотека

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>174) - www.kosmofizika.ru/ )

Peremennye Zvezdy", . ... Received: 9.05.2013; accepted: 29.05.2014 . ... Max . ... Independently discovered by Palaversa et al. (2013), listed as LINEAR 2681145. ... Independently discovered by Palaversa et al. (2013), listed as LINEAR 2686769. ... Independently discovered by Palaversa et al. (2013), listed as LINEAR 2672279. ... Independently discovered by Palaversa et al. (2013), listed as LINEAR 2992494. ... Independently discovered by Palaversa et al. (2013), listed as LINEAR 2997346. ...

Еще в разделе: (Показать все результаты (>6397) - www.astronet.ru/ )

The site content is primarily OS/2-oriented, although I also keep large sections dedicated to music (rock/pop lyrics, MIDI XG files). ... If you already know what you want, you might try search . ... Currently, HTTP transfers are limited to files smaller than 128KB. ... Multi-file downloads, however, are always through HTTP. ... Please do not send me questions like "how to use this file which I found on your site" or "where can I find the best MPEG3 player for Windows95", I will not answer them. ...

Еще в разделе: (Показать все результаты (>3738) - crydee.sai.msu.ru/ )

• XFree86/OS2 Available Ported Software - Tools
• Installing the System
• References

... Natalya V. Raguzova and Sergei B. Popov . ... We present a compilative catalogue of Be/X-ray binaries and candidates in the Galaxy and in the Large and Small Magellanic Clouds. This catalogue contains 160 sources and provides information on names and spectral types of optical components, distances, on spin characteristics of neutron stars, and on orbital and X-ray properties of binary systems. ... Be/X-Ray Binaries and candidates in the Galaxy . Galactic sources: comments to the Table 1 . ...

Еще в разделе: (Показать все результаты (>424) - xray.sai.msu.ru/ )

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>26462) - mirror.msu.net/ )

PHP Manual . ... Yes, PHP can access virtually any database available today. ... I upgraded to PHP 4, and now mysql keeps telling me "Warning: MySQL: Unable to save result set in .. ... Another alternative is to use an SQL server that has Windows ODBC drivers and use that to store the data, which you can then access from Microsoft Access (using ODBC) and PHP (using the built in drivers), or to use an intermediary file format that Access and PHP both understand, such as flat files or dBase databases. ...

Еще в разделе: (Показать все результаты (>918) - oit.cmc.msu.ru/ )

• LDAP functions
• Database (dbm-style) abstraction layer functions
• Complete list of configure options

... Копылов А.М. доктор химических наук, профессор Химического факультета МГУ им. М.В. Ломоносова . Спиридонова В.А. кандидат химических наук, старший научный сотрудник НИИ физико-химической биологии им. А.Н. Белозерского МГУ им. М.В. Ломоносова . Смирнова И.Г. кандидат химических наук, старший научный сотрудник Химического факультета МГУ им. М.В. Ломоносова . Головин А.В. - кандидат химических наук, старший преподаватель факультета Биоинфоматики и биоинженерии МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>39963) - dualopt1.cmm.msu.ru/ )

• AndreyGolovin - Main - TWiki
• AlexKopylov - Main - TWiki
• ElenaZavyalova - Main - TWiki

. Maximum RPM: Taking the Red Hat Package Manager to the Limit . Prev . Appendix C. Concise RPM Command Reference . Next . RPM's rebuild database mode is used to rebuild an RPM database: . Format: rpm --rebuilddb <options> . Only the global options may be used. Prev . Home . Next . Initalize Database Mode . Up . Available Tags For --queryformat

Еще в разделе: (Показать все результаты (>678) - uneex.lorien.cs.msu.su/ )

• Real-World Package Building
• SSL/TLS Strong Encryption: Compatibility - Apache HTTP Server
• Build and Install Platform Detection

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>335) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>122) - classic.chem.msu.su/ )

... Ariskin A.A., Bouadze K.V., Meshalkin S.S., Tsekhonya T.I. (1992) INFOREX: A database on experimental studies of phase relations in silicate systems. ... Meshalkin S.S., Ariskin A.A., Barmina G.S., Nikolaev G.S., Almeev R.R. (1996) Development of a database on experimental crystal-melt equilibria for igneous rocks: INFOREX system, version-3.0. ... Meshalkin S.S., Ariskin A.A. (1996) INFOREX-3.0: A database on experimental phase equilibria in igneous rocks and synthetic systems. ...

Еще в разделе: (Показать все результаты (>299) - geo.web.ru/ )

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>200) - www.genebee.msu.ru/ )

• GeneBee service

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3040) - kodomo.cmm.msu.ru/ )

• TracImport (diff) тАУ Tanchiki
• TracImport тАУ Tanchiki

... Previous message: [RU-NGI] CMS T2-RU-... in Morgue . ... FYI -------- Forwarded Message -------- Subject: [Noc-managers] New DPM release available in EPEL not compatible with SAM monitoring Date: Fri, 7 Nov 2014 18:36:47 +0100 From: Peter Solagna < peter.solagna at egi.eu > To: NGI Operations Centre managers < noc-managers at mailman.egi.eu > Dear colleagues, the DPM team released in EPEL a new version (v.1.8.9) which will publish the WebDav endpoint in the information system. ...

Еще в разделе: (Показать все результаты (>12108) - theory.sinp.msu.ru/ )

• Sergey Yurievich Vernov (Institute of Nuclear Physics, Moscow State University)
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,