Laboratory for the Study of Byzantium and the Black Sea Region . ... By order of the Rector of Moscow State University, the laboratory was assigned the task of coordinating all research in the areas of Byzantine studies and the history of the Black Sea Region during the middle centuries. ... Included among the staff of the laboratory are a number of highly qualified scholars of the middle centuries, Byzantium, Eastern studies, and information science. ...

Еще в разделе: (Показать все результаты (>130) - hist.msu.ru/ )

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>7) - mouse.belozersky.msu.ru/ )

Infrastructure for statistical education . Since 2003 the UIS RUSSIA team concentrates at statistical domain aiming to implement an infrastructure for statistical education and evidence-based applied analysis and full scale social and economic investigations. The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>80) - srcc.msu.ru/ )

... Di-338 . Современная видовая принадлежность: Miltogramma sumbaricum . Первоначальное написание названия: Miltogramma sumbaricum Rohdendorf, 1935, . ... Первоописание: Rohdendorf B.B. 1935. 64 h. Sarcophaginae . Die Fliegen der Palaearktischen Region 11 [Lieferung 88]. ... P. 49-128. ...

Еще в разделе: (Показать все результаты (>5424) - zmmu.msu.ru/ )

CASE- ERWin. . ... DEVELOPMENT OF INFORMATION SYSTEM FOR MONITORING OF VOLGOGRAD REGION POPULATION HEALTH. Poluboyarov V.V., Sharkevich I.V., Kovalenko T.G. (Volgograd) The conceptual and datalogical models of region population health with use of CASE-tool ER-Win have been developed. ... The purpose of this information system is to perform monitoring of Volgograd region population health. ... 2) Microsoft SQL Server 2000. ... 2000, 3, 1) http://www.medtexnika.ru/spec/normdoc/norm1.htm .. . ...

Еще в разделе: (Показать все результаты (>75) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc15822/doc.pdf
• Internet culture in Tyumen region: FIO Tyumen regional center's work experience

... BLAST databases . RPSBLAST databases Search utilities . bl2seq - given two sequences in FASTA format, find regions of local similarity . blastall - given sequences in FASTA format, find similar sequences in a BLAST database . ... formatdb - create BLAST databases from FASTA sequences Advanced utilities . ... rpsblast - search an RPSBLAST database using the BLAST algorithm . ... BLAST database - A set of protein or nucleotide sequences in a format suitable for efficient searching. ...

Еще в разделе: (Показать все результаты (>1181) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~mashunia/l19201.out
• http://kodomo.cmm.msu.ru/~marine/marina.fasta
• http://kodomo.cmm.msu.ru/~golergka/term3/practice3/vc.search

... Геология >> Общая и региональная геология | ... FIRST INTERNATIONAL CONFERENCE ON SUSTAINABLE DEVELOPMENT IN KARST REGIONS будет проходить 24-27 августа 2001года. ...

Еще в разделе: (Показать все результаты (>687) - geo.web.ru/ )

... Salmonella typhimurium LT2, section... 147 9e-36 >AE008909 AE006468 |AE008909| ... Sbjct: 9915 aaacataaagtgatcgccagctgctttttcgaagcctc 9878 Database : fg Posted date: Dec 18, 2007 6:08 PM Number of letters in database : 12, 243 ,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 21,910 Number of extensions: 1351 ...

Еще в разделе: (Показать все результаты (>2458) - kodomo.fbb.msu.ru/ )

... Войти в систему . ... Другие названия журнала: COLD REGIONS SCIENCE AND TECHNOLOGY , Cold Regions and Technology , Cold Regions, Science and Technology . ... Eglit M.E. , Yakubenko A.E. в журнале Cold Regions Science and Technology , издательство Elsevier BV (Netherlands) , том 108, с. 139-148 . ... Kulinich S.A. , Farzaneh M. в журнале Cold Regions Science and Technology , издательство Elsevier BV (Netherlands) , том 65, ? ...

Еще в разделе: (Показать все результаты (>1044) - istina.msu.ru/ )

• Cambridge Journal of Regions, Economy and Society - журнал | ИСТИНА -
• H-W Hubberten - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Rudenko O. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

News . ... Archive of News . International Conference «Molecular-genetic principles of conservancy of Holarctic mammal biodiversity» . ... A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS) ...

Еще в разделе: (Показать все результаты (>1159) - www.sevin.ru/ )

• Laboratories: Laboratory of Avian's Ecology and Behaviour Control: Goals and
• Экологический Форум - Фундаментальная Экология: who (about regions, market
• Экологический Форум - Фундаментальная Экология: can the value regions there

. 1. Move the cursor to the start of the text block you want to define. 2. Type M-space (the META character followed by a space). This sets a 'mark' at the start of the 'region'. 3. Move the cursor to the end of the text block you want to define as the 'region'. This sets the 'point' at the end of the 'region'. You do not have to type anything to set this 'point', the 'point' is the location of the cursor.

Еще в разделе: (Показать все результаты (>50) - comet.sai.msu.ru/ )

... An Active Region of the Sun . ... 16.06.1998 . ... Hot plasma is seen exploding off the Sun's photosphere and traveling along loops defined by the Sun's magnetic field . ... The TRACE satellite was launched in April with plans to continue high-resolution imaging as the Sun passes Solar Maximum in the next few years. ... Publications with keywords: Sun - active region - solar maximum . Publications with words: Sun - active region - solar maximum . ... An X Class Flare Region on the Sun . ...

Еще в разделе: (Показать все результаты (>8945) - www.astronet.ru/ )

• Sunspots and Solar Active Regions
• Астронет > An Active Region of the Sun
• Астронет > Active Region 1002 on an Unusually Quiet Sun

grdlandmask - Create "wet-dry" mask grdfile from shoreline data base. grdlandmask -G mask _ grd _ file ] -I xinc [ m|c ][/ yinc [ m|c ]] -R west / east / south / north [ r ] [ -A min _ area [/ min _ level / max _ level ] ] [ -D resolution ] [ -F ] [ -N maskvalues [ o ] ] [ -V ] grdlandmask reads the selected shoreline database and uses that information to decide which nodes in the specified grid are over land or over water. ... The resolution drops off by ~80% between data sets. Default is l ]. ...

Еще в разделе: (Показать все результаты (>280) - xray.sai.msu.ru/ )

• http://xray.sai.msu.ru/~polar/xmgr/regions.html
• ADS Abstract Service Results
• Links to Databases

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>132) - www.genebee.msu.ru/ )

• NCBI BLAST Advanced Options
• BLAST Basic Overview
• GeneBee BLAST 2.2.22+ Services Help

... Next: Threshold filtering Up: Data Analysis (Operations Menu) Previous: Surface Corrugation Contents Index . If you have selected a surface region on the surface, then the value of its square can be found using the Command Surface Square . ... Next: Threshold filtering Up: Data Analysis (Operations Menu) Previous: Surface Corrugation Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>52) - www.spm.genebee.msu.ru/ )

• Select surface region
• Changing the size of scanning window

This diagram illustrates two block boxes, one above the other, with rectangular clipping regions of different dimensions. ... Both axes depict increments of 5px. The clipping region of the first P box lies entirely within it, offset 5px from the top and left edges of the P box, and 10px from the right and bottom edges. ... The clipping region of the second P box resembles that of the first in style and position, except that the right edge is 5px to the right of the P box's right edge. ...

Еще в разделе: (Показать все результаты (>834) - crydee.sai.msu.ru/ )

• Album: 2015/08 Tarkhany, Penza region (Russia)
• Album: 2015/06 Muranovo, Moscow Region (Russia)
• Image: Flying. Typical Moscow region landscape is seen below

... 2008 September 24 . Active Region 1002 on an Unusually Quiet Sun . ... Explanation: Why has the Sun been so quiet recently? ... Our Sun has shown few active regions -- that house even fewer associated sunspots -- for over a year now, and such a period of relative calm is quite unusual. ... Visible above, this region, dubbed Active Region 1002 (AR 1002), was imaged in ultraviolet light yesterday by the SOHO spacecraft , which co-orbits the Sun near the Earth. ... About APOD | ...

Еще в разделе: (Показать все результаты (>2251) - www.sai.msu.su/ )

• APOD: 2007 November 6 - An X Class Flare Region on the Sun
• WWW gateway to SAI databases
• APOD: 2008 March 12 - Star Forming Region LH 95

The database of triplet periodicity change points Y.M. Suvorova, E.V. Korotkov Centre of Bioengineering Russian Academy of Sciences, 117312, prospect 60 -tya Oktyabrya 7/1, Moscow, Russia, suvorovay@gmail.com It is well-known that triplet periodicit y (TP) is the dist inguishing feature of protein coding sequences of the majorit y of the living organisms [1]. ... The current version o f the database includes 179 238 records of protein coding sequences with triplet periodicit y change points. ...

Еще в разделе: (Показать все результаты (>201) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/209.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/55.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/53.pdf

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• XAFS Publication Database search form

Электронная библиотека . ... Главная Ex Libris Книги Журналы Статьи Серии Каталог Wanted Загрузка ХудЛит Справка Поиск по индексам Поиск . ... Поиск по указателям . Результат поиска . Книга . Страницы для поиска . ... see "Transition region" . ... see also "Accumulation region" . Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>2940) - lib.mexmat.ru/ )

• Поиск книг, содержащих Region simply connected :: Электронная библиотека
• Поиск книг, содержащих Region path-connected :: Электронная библиотека
• Поиск книг, содержащих Region star-shaped :: Электронная библиотека