Поиск по:www.genebee.msu.ru -
Поискать по всем серверам
На этой странице приведены все страницы сервера www.genebee.msu.ru ,которые мы индексируем. Показаны документы 21 - 40 из 363.
Упорядочить по:
URL
|
дате изменения
21. GeneBee BLAST 2.2.22+ Services .
About Blast 2.2.22+ . Blast FAQ . Basic options . ... Advanced options . ... Other advanced options : . Format options . ... Pairwise Query-anchored showing identities Query-anchored no identities Flat query-anchored, show identities Flat query-anchored, no identities Query-anchored no identities and blunt ends Flat query-anchored, no identities and blunt ends . Descriptions : 0 10 50 100 . Alignments : 0 10 50 100 . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast_2.2.22/blastform.php?program=blastx -- 7.9 Кб -- 01.10.2012
Похожие документы
Похожие документы
22. GeneBee BLAST 2.2.22+ Services .
About Blast 2.2.22+ . Blast FAQ . Basic options . ... Advanced options . ... Other advanced options : . Format options . ... Pairwise Query-anchored showing identities Query-anchored no identities Flat query-anchored, show identities Flat query-anchored, no identities Query-anchored no identities and blunt ends Flat query-anchored, no identities and blunt ends . Descriptions : 0 10 50 100 . Alignments : 0 10 50 100 . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast_2.2.22/blastform.php?program=blastp -- 7.9 Кб -- 01.10.2012
Похожие документы
Похожие документы
23. GeneBee BLAST 2.2.22+ Services .
About Blast 2.2.22+ . Blast FAQ . Basic options . ... Choose Database : . ... Choose taxon . ... Advanced options . Choose filter : . ... Other advanced options : . Format options . ... Pairwise Query-anchored showing identities Query-anchored no identities Flat query-anchored, show identities Flat query-anchored, no identities Query-anchored no identities and blunt ends Flat query-anchored, no identities and blunt ends . Descriptions : 0 10 50 100 . Alignments : 0 10 50 100 . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast_2.2.22/blastform.php?program=blastn -- 8.2 Кб -- 01.10.2012
Похожие документы
Похожие документы
24. GeneBee BLAST 2.2.8 Services
About Blast 2.2.8 . Blast FAQ . ... nt Human Mus musculus Rodents Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage Synthetic Unclassified Patents STSs HTC Human HTGs Human HTGs phase0 Invertebrate HTGs Invertebrate HTGs phase0 Rodent HTGs Rodent HTGs phase0 Mouse HTGs Mouse HTGs phase0 Vertebrate HTGs Plant HTGs Other HTGs Fungi GSSs Human GSSs Mouse ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=tblastn -- 9.7 Кб -- 01.10.2012
[ Сохраненная копия ] Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=tblastx -- 9.7 Кб -- 01.10.2012
Похожие документы
[ Сохраненная копия ] Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=tblastx -- 9.7 Кб -- 01.10.2012
Похожие документы
25. GeneBee BLAST 2.2.8 Services
About Blast 2.2.8 . Blast FAQ . Basic options . ... Advanced options . ... Other advanced options : . Format options . ... Pairwise Query-anchored showing identities Query-anchored no identities Flat query-anchored, show identities Flat query-anchored, no identities Query-anchored no identities and blunt ends Flat query-anchored, no identities and blunt ends . Descriptions : 0 10 50 100 . Alignments : 0 10 50 100 . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=blastp -- 7.7 Кб -- 01.10.2012
[ Сохраненная копия ] Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=blastx -- 7.7 Кб -- 01.10.2012
Похожие документы
[ Сохраненная копия ] Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=blastx -- 7.7 Кб -- 01.10.2012
Похожие документы
26. GeneBee BLAST 2.2.8 Services
About Blast 2.2.8 . Blast FAQ . ... nt Human Mus musculus Rodents Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage Synthetic Unclassified Patents STSs HTC Human HTGs Human HTGs phase0 Invertebrate HTGs Invertebrate HTGs phase0 Rodent HTGs Rodent HTGs phase0 Mouse HTGs Mouse HTGs phase0 Vertebrate HTGs Plant HTGs Other HTGs Fungi GSSs Human GSSs Mouse ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast_new/blastform.php?program=blastn -- 9.6 Кб -- 01.10.2012
Похожие документы
Похожие документы
27. GeneBee Graphical Alignment - Advanced
... GeneBee . ... AliGraf - GeneBee Graphical Image of Alignment . ... Alignment title . ... Picture Options . Picture size . ... DNA/RNA Dayhoff Johnson Blosum 30 Blosum 50 Blosum 62 Pam 60 Pam 120 Pam 250 Gonnet 120 Gonnet 250 Gonnet 350 . Picture types . All groups Max group at column Column values Column values (best-to-worst) . ... Add picture with . ... Enter or Paste here your alignment in Genebee or Clustal (ALN) format . Alignment example: . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/services/aligraf/advanced.html -- 16.8 Кб -- 01.10.2012
Похожие документы
Похожие документы
28. GeneBee Graphical Alignment - Advanced
... GeneBee . ... AliGraf - GeneBee Graphical Image of Alignment . ... Advanced query . Alignment title . ... All groups Max group at column Column values Column values (best-to-worst) . Enter or Paste here your alignment in Genebee or Clustal (ALN) format . Alignment example: . ... Last updated: August 26, 2001. Comments and bug-reports send to: nik@genebee.msu.su ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/services/aligraf/basic.html -- 8.6 Кб -- 01.10.2012
Похожие документы
Похожие документы
29. AliGraf - GeneBee Graphical Alignment Help
AliGraf - GeneBee Graphical Alignment Help Type in a title for this session for you to remember. ... Type in an alignment algorith name (Genebee, ClustalW, Manual.. ... Even - all column space are colored; Sparse - every column is colored with respect to the column weight: less weight more space is left uncolored; Very sparse - more space is left uncolored. ... Also you can get a picture when only selected groups are colored. ... Group set depends on selected group type. ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/services/aligraf/help.html -- 10.1 Кб -- 01.10.2012
Похожие документы
Похожие документы
30. GEA :: Gene Expression Analysis
... Control question . Control answer . GEA is a system for the analysis of micro-array experiments results. It includes modules for background correction an normalization ( NM stage ), principal component analysis ( PCA stage ), clusterization ( CL stage ), quality control ( QC stage ), and main vector determination ( MV stage ). ... It is based on the evaluation of eigenvalues and eigenvectors in the gene space and the analysis of eigenvectors that correspond to the greatest eigenvalues. ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/~nikonov/GEA/ -- 8.5 Кб -- 01.10.2012
Похожие документы
Похожие документы
31. GeneBee MegaBlast Service
About MegaBlast . About Blast . ... nt Human Mus musculus Rodents Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage Synthetic Unclassified Patents STSs HTC Human HTGs Human HTGs phase0 Invertebrate HTGs Invertebrate HTGs phase0 Rodent HTGs Rodent HTGs phase0 Mouse HTGs Mouse HTGs phase0 Vertebrate HTGs Plant HTGs Other HTGs Fungi GSSs Human ... Comments and bug-reports send to: nik@genebee.msu.su . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/megablast/megablast.php -- 5.8 Кб -- 01.10.2012
Похожие документы
Похожие документы
32. Fasta 3.4
... Basic Fasta 3.4 . ... DataBases including EST . Swissprot Trembl Swissprot + Trembl Human Mus musculus Rodents Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage Synthetic Unclassified Patents STSs HTC Human HTGs Human HTGs phase0 Invertebrate HTGs Invertebrate HTGs phase0 Rodent HTGs Rodent HTGs phase0 Mouse HTGs Mouse HTGs phase0 Vertebrate HTGs Plant ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/fasta/fasta_basic3.php -- 5.8 Кб -- 01.10.2012
Похожие документы
Похожие документы
33. Fasta 3.4
... Belozersky Institute . ... Basic Fasta 3.4 . ... fasta fastx fasty tfastx tfasty fastf tfastt fasts tfasts . ... Swissprot Swissprot + Trembl Human Rodentes Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage High Throughput Genome Genome Survey Sequences Synthetic Unclassified est_hum est_rod est_mam est_vrt est_inv est_pln est_fun est_pro . ... BLOSUM45 BLOSUM50 BLOSUM80 BLOSUM62 PAM30 PAM70 . Enter or Paste here your sequence in FASTA format . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/fasta/fasta_basic.php3 -- 5.2 Кб -- 01.10.2012
Похожие документы
Похожие документы
34. Genebee Advanced BLAST 2.0
Advanced Blast 2.0 . ... Human Rodentes Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage Human HTGs Invertebrate HTGs Mus musculus HTGs Plant HTGs Rodent HTGs Other HTGs Fungi GSSs Human GSSs Invertebrate GSSs Mammals GSSs Plant GSSs Prokaryote GSSs Mus musculus GSSs Vertebrate GSSs Other GSSs Synthetic Unclassified EST Human EST Rodentes EST Other Mammals EST Other Vertebrates EST Invertebrates EST Plants EST Fungi EST Prokaryotes . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast/blastform3.php3 -- 7.2 Кб -- 01.10.2012
Похожие документы
Похожие документы
35. GeneBee Basic BLAST 2.0
Basic Blast 2.0 . ... DataBases . ... Human Rodentes Other Mammals Other Vertebrates Invertebrates Plants Fungi Prokaryotes Organelles Viruses Bacteriophage Human HTGs Invertebrate HTGs Mus musculus HTGs Plant HTGs Rodent HTGs Other HTGs Fungi GSSs Human GSSs Invertebrate GSSs Mammals GSSs Plant GSSs Prokaryote GSSs Mus musculus GSSs Vertebrate GSSs Other GSSs Synthetic Unclassified EST Human EST Rodentes EST Other Mammals EST Other Vertebrates EST Invertebrates EST Plants EST Fungi EST Prokaryotes . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/blast/blastform2.php3 -- 4.7 Кб -- 01.10.2012
Похожие документы
Похожие документы
36. OrfBee ORF predictor
... GeneBee . ... OrfBee - GeneBee ORF prediction . ... Segment Length Low Threshold . Maximal Number of Segments . Potential Function . ... Potential Function Frame Size . Potential Function Gap Value . Threshold of coding region start . Threshold of segment score . Threshold of score difference . ... Yes No . ... Stop codon start new segment . ... Any comments or suggestions are welcomed at: nik@genebee.msu.su ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/service/orfbee.php -- 6.7 Кб -- 01.10.2012
Похожие документы
Похожие документы
37. RNA secondary structure prediction
... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/services/rna2_reduced.html -- 6.0 Кб -- 27.09.2012
Похожие документы
Похожие документы
38. http://www.genebee.msu.ru/services/ss_help.html
... Keywords Query and List of the fileds in the bank's records. Query Sequence. List of Banks to do screenining. Screening consists of two stages: . First stage: Screening by keyword . Only those sequences from the specified banks are selected which in the specified fields contain given keywords. Second stage: Screening by Similarity . The screening is made exactly only for those sequences, which were selected on the first stage. ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/services/ss_help.html -- 3.4 Кб -- 27.09.2012
Похожие документы
Похожие документы
39. http://www.genebee.msu.ru/services/Kw-help.html
... to search for databank entries with query keywords presented in entire info texts of entries . ... Every ENTRY describes one sequence or 3D-structure and consists of a number of FIELDS. ... proteinase AND cleave ( both should be in ALL text info fields of selected entries). ... Termination line. ... This line consists of the entry name, data class, the word 'PRT' which means molecule type (PRoTein), and sequence length. ... These lines show the date of entry or last modification of the sequence...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/services/Kw-help.html -- 42.0 Кб -- 27.09.2012
Похожие документы
Похожие документы
40. GeneBee Services
... GeneBee . ... Supported by the Russian Foundation for Basic Research, grant 10-07-00685-a . ... Services . ... Some services of GeneBee are mirrored at the servers of Bri-shur project . ... Databanks screening . Sequence analysis . ... AliBee - Multiple alignment Release 3.0 . Pipeline Screening: Keyword -> Similarity . ... Screening by similarity Release 3.0 . ... Gene Expression Analysis . GEA - System for Gene Expression Analysis . ... GeneBee Group Collaboration Research . ...
[
Сохраненная копия
]
Ссылки http://www.genebee.msu.ru/genebee.html -- 10.2 Кб -- 29.06.2012
Похожие документы
Похожие документы