XWare Поиск по информационным ресурсам МГУ English Russian
       
       Точная форма слов   О проекте   Сайты   Помощь
Поиск по:herba.msu.ru   - Поискать по всем серверам
На этой странице приведены все страницы сервера herba.msu.ru ,которые мы индексируем. Показаны документы 1621 - 1640 из 11385.

В начало ] Пред. | 78 | 79 | 80 | 81 | 82 | 83 | 84 | 85 | 86 | 87 | След.В конец ]

Упорядочить по: URL  |  дате изменения
1621. http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/grasses/grasses_persentation.pdf
... Main Points Covered Historical Biogeography of Danthonioideae Lag Time Dispersal Routes Ecological control of distribution ranges Historical Biogeography of Danthonioideae This map shows the estimated dispersal routes of the subfamily Danthonioideae. ... Lag Time A "lag time" is the waiting time between when the species you're observing arrives in an area and the first dispersal (to leave a trace) from that area. These lag times can often be many years. ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/grasses/grasses_persentation.pdf -- 401.3 Кб -- 05.03.2014
Похожие документы

1622. http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/north_dakota/north_dakota_presentation.pdf
GEOGRAPHICAL AFFINITIES OF THE F L O R A O F N O RT H D A K O TA Velva E. Rudd NORTH DAKOTA HAS 2 PHYSIOGRAPHIC PROVINCES North Dakota is divided into 2 physiographic provinces: Central Lowlands and the Great Plains. ... However, as the Rocky Mountains continued to develop, the inflow of humid air and the precipitation from the Pacific Ocean decreased and caused the region to become more arid and the area started to become more of a grassland. ... This prevents many species from becoming established. ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/north_dakota/north_dakota_presentation.pdf -- 459.4 Кб -- 26.02.2014
Похожие документы

1623. http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/madagascar/madagascar_presentation.pdf
... Wa r r e n , D o m i n i q u e S t ra s b e r g , J. He n r i c h B r u g ge m a n n , R o b e r t P. P r y s - Jo n e s a n d C h r i s t o p h e T h И s b a u d Despite Madagascar's extreme isolation from India and proximity to Africa, a high proportion of the biota of the Madagascar region has Asian affinities. ... Long distance dispersal events may attribute to the biota of Madagascar First, the Indian winter monsoon winds blow from the Indian subcontinent towards the Madagascar region. ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/madagascar/madagascar_presentation.pdf -- 644.2 Кб -- 19.02.2014
Похожие документы

1624. http://herba.msu.ru/shipunov/school/books/chemeris2004_rastit_pokrov_istokovykh_wetlandov_sev_povolzjja.pdf
e. b. )еме!," p="2,2ель.../L C%*!%" ,"2%*%"/. "е2л=...д%" . . . 2004 581.526.3 (470.31) 28.58 . . . : ' ', 2004. 158 . + xxvi. ISBN 5-88697-123-8 C , , , , , , .., . . -. , , , . . . , , , , . : ... . . : ... . . ... . . 25 2004 . ' ' -- 10 2004 . ISBN 5-88697-123-8 © . . , 2004 © . . . , 2004 ................................................................................................................... 4
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/books/chemeris2004_rastit_pokrov_istokovykh_wetlandov_sev_povolzjja.pdf -- 1860.1 Кб -- 17.02.2014
Похожие документы

1625. http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/sweet_potato/sweet_potato_presentation.pdf
... Uses nuclear and chloroplast microsatellite markers -Peru-Ecuador region as Southern Gene Pool (Kumara line) -Caribbean and Central America region as Northern Gene pool (Batata and Camote lines) GEOGRAPHICAL DISTRIBUTION Collections from Tropical America , Oceania , and Southeast Asia K1 nuclear cluster = Southern Gene Pool K2 nuclear cluster = Northern Gene ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/biol_330/2013_2014/presentations/sweet_potato/sweet_potato_presentation.pdf -- 1443.1 Кб -- 12.02.2014
Похожие документы

1626. http://herba.msu.ru/shipunov/school/biol_330/2013_2014/chronostrat_chart_2013_01.pdf
L C H R O N O S T R AT I G R A P H I C C H A R T www.stratigraphy.org Eonothem Erathem International Commission on Stratigraphy GSSP / Eon System / Era / Period Eonothem Erathem v 2013 /01 GSSP GSSA / Eon System / Era / Period Erathem GSSP / Eon System / Era / Period Eonothem Series / Epoch Stage / Age numerical age (Ma) present GSSP Series / Epoch Stage / Age numerical age (Ma) ~ 145.0 Series / Epoch Stage / ... Numerical ages for and Precambrian Gradstein et al. ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/biol_330/2013_2014/chronostrat_chart_2013_01.pdf -- 297.6 Кб -- 24.01.2014
Похожие документы

1627. BIOL 310: Ethnobotany
Shipunov, A. Ethnobotany [Electronic resource]. 2011 onwards. Mode of access: http://ashipunov.info/shipunov/school/biol_310 . ... Syllabus (PDF, 0.14 Mb) updated 03/01/2013! ... Fundamentals of pharmacognosy and phytotherapy" (DjVu*, 3.5 Mb) . Old lectures . Lecture 1 (PDF, 0.4 Mb) . ... Lecture (excursion) 22 (PDF, 0.1 Mb) . ... Lectures 34 and 35 (PDF, 2.0 Mb) . ... Plant list and guidelines for ethnobotany presentation (PDF, 0.1 Mb) . Lab 6: Voynich manuscript (DjVu*, 20 Mb) . ...
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/biol_310/2012_2013/index.htm -- 5.4 Кб -- 15.01.2014
Похожие документы

1628. BIOL 448: Systematic Botany
Shipunov, A. 2011 onwards. Systematic Botany [Electronic resource]. Mode of access: http://ashipunov.info/shipunov/school/biol_448/index.htm . Class materials: . Syllabus (PDF, 0.15 Mb) . ... Lecture 1 (PDF, 0.2 Mb) . ... Lab 12 materials . Old materials (2011) . ...
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/biol_448/2013_fall/index.htm -- 2.9 Кб -- 13.12.2013
Похожие документы

1629. http://herba.msu.ru/shipunov/belomor/2013/zoolog/dytiscus.pdf
V 2013 1 59(063) 28.691.89431 46 : V / . 2013. ... Hydroentomology in Russia and adjacent countries: Materials of the Fifth All-Russia Symposium on Amphibiotic and Aquatic Insects / Papanin Institute for Biology of Inland Waters, Russian Academy of Sciences. ... V DYTISCUS LAPPONICUS (COLEOPTERA, DYTISCIDAE) GEOGRAPHIC VARIATION OF COLORATION AND FLIGHT CAPACITY IN ADULTS OF DYTISCUS LAPPONICUS (COLEOPTERA, DYTISCIDAE), BASED ON MATERIALS FROM THREE REGIONS OF RUSSIA REMOTE FROM EACH OTHER .. ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/belomor/2013/zoolog/dytiscus.pdf -- 279.7 Кб -- 22.10.2013
Похожие документы

1630. http://herba.msu.ru/shipunov/belomor/english/2013/island.pdf
... We investigated the influence of islands' attributes on species richness and rates of flora dynamics. ... The species number for islet-like islands correlated positively with number of habitats, abundance of different habitat types and island area. Species richness of stonelike islands correlated positively only with number of habitat types. ... The species number for islet-like islands correlate positively with number of habitats, abundance of different habitat types and island area. ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/belomor/english/2013/island.pdf -- 711.0 Кб -- 27.08.2013
Похожие документы

1631. BIOL 592: Working with Organisms in the Classroom. Plants
. Shipunov, A. BIOL 592: Plants and Other Organisms in the Classroom (Part II: Plants) [Electronic resource]. 2011 onwards. Mode of access: http://ashipunov.info/shipunov/school/biol_592 . Course materials: . Old presentations . Seminar 1 (PDF, 1.4 Mb). Most important plant families . Seminar 2 (PDF, 0.05 Mb). Collecting plants (links to resources) . Seminar 3 (PDF, 0.3 Mb). Plants and plants . Seminar 4 (PDF, 0.9 Mb). Life cycles . Back
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/biol_592/index.htm -- 2.1 Кб -- 19.07.2013
Похожие документы

1632. http://herba.msu.ru/shipunov/moldino/fotografii/ljudi/gruppovye/index.htm
1996.jpg, 2010-12-01, 1.1 Mb, 1996 год . 1998.jpg, 2012-06-26, 1.6 Mb, 1998 год . 1999.jpg, 2012-06-26, 1.3 Mb, 1999 год . 2006.jpg, 2012-06-26, 1.5 Mb, 2006 год . 2007.jpg, 2012-06-26, 1.7 Mb, 2007 год . 2008.jpg, 2012-06-26, 1.5 Mb, 2008 год . 2009.jpg, 2012-06-26, 1.2 Mb, 2009 год . 2010.jpg, 2012-06-26, 1.4 Mb, 2010 год . 2011.jpg, 2012-06-26, 1.7 Mb, 2011 год . 2012.jpg, 2012-07-07, 3.3 Mb, 2012 год . 2013.jpg, 2013-07-06, 1.9 Mb, 2013 год .
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/moldino/fotografii/ljudi/gruppovye/index.htm -- 2.6 Кб -- 12.07.2013
Похожие документы

1633. BIOL 250: Advanced Cell Biology
Shipunov, A. Advanced Cell Biology [Electronic resource]. 2011 onwards. Mode of access: http://ashipunov.info/shipunov/school/biol_250 . ... Syllabus (PDF, 0.15 Mb) . Students (exams, quizzes, labs) (Excel, 0.2 Mb) . Old lectures . ... Lecture 1 (PDF, 0.4 Mb) . ... Lecture 23 (PDF, 2.0 Mb); Memczac et al. (2013) paper about circRNAs (PDF, 0.7 Mb) . Lectures 24-25 (PDF, 3.0 Mb) . ... Lectures 34 and 35 (PDF, 2.8 Mb) . ... Lab 3 (PDF, 0.3 Mb) DNA extraction. ...
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/biol_250/index.htm -- 4.9 Кб -- 03.05.2013
Похожие документы

1634. http://herba.msu.ru/shipunov/school/biol_250/example_fasta.txt
asiatica_asi_its2_bold TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACG CCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCC CTACACCAATTTGGTGCGGGGGCGGATAATGGCATCCCGTTAGCTCGGTT TGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGA AAGATCATTGGTGCCGTTGTGCTTCACTCCGTCGCATGCTTGGGCATCGT TACAAAACAATGGTGCTAACGCGCCTTCGACCGCGACCCCAGGTCAGACG GGACTACCCGCTGAGTTTA ...
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/biol_250/example_fasta.txt -- 2.4 Кб -- 22.04.2013
Похожие документы

1635. http://herba.msu.ru/shipunov/school/biol_250/our_plantains_fasta.txt
arachnoidea_p8_its2 TCTGACTGGGGTCGCGGTCGAAGGCGCTTTAGCACCATTGTTTTATT ACGATGCCCAAGCATGCGACAGAGTGAAGCACAACGACACCAATGAT CTTTCAACCACCACTGGTTGTGACATCCGTCGATGAGGGATCATTTTTGG GCAAACCGAGCTAACGGGATGCCATTTTCCGCCCCGCACCAAA TTGGTATGGGGGCGACGCGATGCGTGACGCCCAGGCAGGCGTG CCCTCAGCCCGAAGGCGTCGGGCGCAACTTGCGTTCAAAGACTCGATGGT TCACGGGATTCTGCAATTCACACCAAGTATCGCATA canescens_p11_its2 TCTGACTGGGGTCGCGGTCGAAGGCGCGTTAGCACCATTGTTTTATT ACGATGCCCAAGCATGCGACAGAGTGAAGCACAACGACACCAATGAT ...
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/biol_250/our_plantains_fasta.txt -- 4.8 Кб -- 22.04.2013
Похожие документы

1636. http://herba.msu.ru/shipunov/school/books/esenbekova2013_heteroptera_kz.pdf
.. (HETEROPTERA) ґ 2013 592/595/07/ 28.67 79 79 (Heteroptera) . .. ґ : ?-?, 2013. ґ 349 . ISBN 978-601-80265-5-3 , , . . , , . .. (Heteroptera). ґ : ?-?, 2013. ґ 349 . , , . . , , . Esenbekova P.A. Bugs (Heteroptera) of Kazakhstan. - Almaty: "Nur-print", 2013. ґ 349 p. The monography is devoted to the description of taxono mic structure, distribution, ecological and biological features of Heteroptera of Kazakhstan. It is the handbook about one of large and important in ecological and practical relation
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/books/esenbekova2013_heteroptera_kz.pdf -- 1806.2 Кб -- 20.04.2013
Похожие документы

1637. Библиотека "Флора и фауна"
. растения, животные, грибы и водоросли, теория эволюции и систематики . Библиотека доступна по адресам: 1 ; 2 * ; 3 ** . Область . Тип книги . Год . Название, формат и ссылка . Размер, Mb . Добавлено . Комментарий
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/school/src/sch-ru_.head -- 2.1 Кб -- 27.03.2013
Похожие документы

1638. http://herba.msu.ru/shipunov/school/books/nedoluzhko2011_flora_ostr_russkij.pdf
... 1860 .) ... The history of the plant covers studies in the Russian Island including both Maximowicz's (1860), Desoulavi's (1921, 1922), Krylov's (1922) etc works and the studies of the authors is resulted. ... 1998), (, 19011907, 1923; , 1931; , 1982; .) ... 1889 1890 . ... 1921 1922 . ... 1998, 1999 2000 . ... Alnus japonica. ... ACERACEAE ґ Acer barbinerve Maxim. ... Angelica anomala auct, non Ave-Lall.) ... Hafen Dundas in der Bai Victoria (Mandshuria), 1 IX 1860, C. Maximowicz?; 1922, H. . ...
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/books/nedoluzhko2011_flora_ostr_russkij.pdf -- 467.7 Кб -- 20.02.2013
Похожие документы

1639. http://herba.msu.ru/shipunov/school/books/smirnov2008_kaktusy_v_domashnej_kollektsii_i_pod_otkrytym_nebom.pdf
DZdlmku \ ^hfZrg_c dhee_dpbb b ih^ hldjuluf g_[hf H L : < L HJ : M \ e _ q _ g b _ d Z d l m k Z f b m \ k _ o g Z q b g Z _ l k ye y h f _ j g y ghhgf h g Z q Z e h k v k ^ \ m o .> i Za m jZkl _g bcih ^Z j _g gu o a gZdhf uf dZdl, m kbkl h if Zd _lbdh \ . _fy g l jy g Z , b ^ \mo k G _kfh m ^Z q gu c ihk _ \ wl bo , k _f yg fZe _gvdZy ee _dp?by _kdh evdh e _l i j _[u \ ZeZ \ aZ[ \ _gb b ? dh g . GZklh ys bc bgl _ j _k ihy \beky ebrv k gZ qZeh f j _] m ey jg , ba]h k _ \h \ _g b _f uo i h lh \e k _f yg
[ Текст ]  Ссылки http://herba.msu.ru/shipunov/school/books/smirnov2008_kaktusy_v_domashnej_kollektsii_i_pod_otkrytym_nebom.pdf -- 2657.0 Кб -- 11.02.2013
Похожие документы

1640. Биологическая станция "Озеро Молдино". Материалы
. Определитель водных макрофитов оз. Молдино по вегетативным признакам . Особенности поведения цветков кувшинки белой ( Nymphaea candida Presl.) в озере Молдино Тверской области . Данные по листорасположению у растений Средней России
[ Сохраненная копия ]  Ссылки http://herba.msu.ru/shipunov/moldino/nauka/1998/index.htm -- 1.6 Кб -- 10.02.2013
Похожие документы

В начало ] Пред. | 78 | 79 | 80 | 81 | 82 | 83 | 84 | 85 | 86 | 87 | След.В конец ]

Rambler's Top100 RFBR Яндекс цитирования