... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>1459) - oit.cmc.msu.ru/ )

Электронная библиотека Попечительского совета . ... Wehrle K., Pahlke F., Ritter H. - Linux Network Architecture . ... Название: Linux Network Architecture . Авторы: Wehrle K., Pahlke F., Ritter H. Аннотация: . This unique Linux networking tutorial/reference by experts provides readers with a practical overview and understanding of the implementation of networking protocols in the Linux kernel. ... Bluetooth in Linux . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>21973) - lib.mexmat.ru/ )

... Use of general datatypes in communication . Up: Derived datatypes Next: Correct use of addresses Previous: Commit and free . Handles to derived datatypes can be passed to a communication call wherever a datatype argument is required. ... Similar statements apply to all other communication functions that have a count and datatype argument. ... The use of such a datatype in a receive operation is erroneous. ... IN datatype] datatype used by receive operation (handle) . ... Центры . ...

Еще в разделе: (Показать все результаты (>728) - www.parallel.ru/ )

• Type matching rules | PARALLEL.RU - Информационно-аналитический центр по
• Introduction | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Derived datatypes | PARALLEL.RU - Информационно-аналитический центр по

... The Network Time Protocol (NTP) is used to synchronize the time of a computer client or server to another server or reference time source, such as a radio or satellite receiver or modem. ... Information on the NTP architecture, protocol and algorithms can be found in the Further Information and Bibliography page. The Building and Installing the Distribution page presents an overview of the procedures for compiling the distribution and installing it on a typical client or server. ...

Еще в разделе: (Показать все результаты (>6137) - www.sai.msu.su/ )

• Further Information and Bibliography
• Miscellaneous Options
• xntpd - Network Time Protocol (NTP) daemon

... Used to translate IP addresses into physical hardware addresses. ... The opposite of RISC , a processor which supports a large number of often complex assembly instructions. ... This is a set of data in memory comprised of fields, . ... This object file format designed by the Unix System Laboratories is now firmly established as the most commonly used format in Linux. ... A protocol is a networking language used to transfer application data between two cooperating processes or network layers. ...

Еще в разделе: (Показать все результаты (>698) - itpm.msu.su/ )

• The Internet Protocol
• All About ifconfig
• The Transmission Control Protocol

Network Working Group Request for Comments: 1581 Category: Informational G. Meyer Spider Systems February 1994 Protocol Analysis for Extensions to RIP to Support Demand Circuits Status of this Memo This document provides information for the Internet community. document does not specify an Internet standard of any kind. ... 3.4 Routing Information Flow Control If the circuit manager reports a circuit as down, the routing application is flow controlled from sending further information on the circuit. ...

Еще в разделе: (Показать все результаты (>25288) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1581.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1868.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc906.txt

A collection class is a class that can contain a number of items in a certain data structure and perform operations on the contained items; insert, remove, find etc. ... QList ; a doubly linked list structure. ... An iterator is a class for safely traversing the items in a collection: . ... Qt has an array template class, QArray , which stores the items directly in the array. ... We discuss QList here, but the same applies for all collection classes and all collection class iterators. ... Classes: . ...

Еще в разделе: (Показать все результаты (>800) - rtm-cs.sinp.msu.ru/ )

• Apache name-based Virtual Hosts
• XML-RPC Specification
• sendmail address rewriting mini-HOWTO

TWiki . Our RNA 3D structure prediction web service . ... WebNotify . This is a subscription service to be automatically notified by e-mail when topics change in this Services web. ... Users subscribe to email notifications using their WikiName or an alternative email address, and can specify the webs/topics they wish to track, Whole groups of users can also be subscribed for notification. ... Changes in all these children will be detected and reported along with changes to the topic itself. ...

Еще в разделе: (Показать все результаты (>41852) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (6 vs. 7) - TWiki
• %TOPICTITLE% (3 vs. 4) - TWiki
• %TOPICTITLE% (4 vs. 5) - TWiki

Electronic mail programs do not provide you with the equivalent to a telephone directory: there is no way that you can look up a person's electronic mail address. ... For example: Date: Tue, 18 Aug 92 12:15:17 WET DST From: tony@bigfish.com Subject: Xgator troubles To: john@castle.ed.ac.uk . ... For example: From: john@ed.ac.uk Subject: Address please To: postmaster@durham Please provide the email address for Dr J.R. Dozer who is a member of staff in the Psychology Dept. ...

Еще в разделе: (Показать все результаты (>616) - comet.sai.msu.ru/ )

• Trapping operating system signals
• Structure of the file system
• UNIXhelp Glossary - "B"

... Numeration assumed . ... All contacts alignment . ... For this study 20 PDB-entries containing coordinates of ETS domains were used. These entries represent 10 proteins from two species: Homo sapiens and Mus musculus . ... X-ray . ... Yes . ... Homo sapiens . ... ETS-1 . ... The sequence alignment of all studied ETS domains . ... The alignment obtained reveals the conservative trinucleotide core GGA , which is recognized by ETS domain and is usually called EBS (ETS Binding Site). ...

Еще в разделе: (Показать все результаты (>6263) - monkey.belozersky.msu.ru/ )

• HTH3_numeration_assumed
• PDB entries containing domains of the family "Reverse transcriptase connection
• SDP home page

... The question is, how to get a machine with one network interface to respond to more than one IP addresses. ... changes (most likely only in the includes). ---------------------netinet/if_vif.h-------------------------------------- typedef struct { struct ifnet vif_if; struct ifnet *vif_sif; /* slave interface */ int vif_flags; } vif_softc_t; #define VIFMTU (1024+512) --------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>124) - neptun.sai.msu.ru/ )

• Name-based Virtual Hosts
• Source Re-organisation
• Apache module mod_auth_anon.c

... Building Packages for Multiple Architectures and Operating Systems . ... The key to exerting this kind of platform-specific control in the spec file is to use RPM's conditionals. ... The first thing is that conditionals are block-structured. ... ifos Linux Summary: This is a package for the Linux operating system %endif . ... ifarch i386 echo "This is an i386" %ifos Linux echo "This is a Linux system" %else echo "This is not a Linux system" %endif %else echo "This is not an i386" %endif . ...

Еще в разделе: (Показать все результаты (>1099) - uneex.lorien.cs.msu.su/ )

• Building Packages: A Simple Example
• mod_dav - Apache HTTP Server
• Build and Install Platform Detection

... DevHlp_Security This devhlp allows to open a file for read access in the Init routine of a BASEDEV . ... returned: size of file SYIOpenFile ends Valid at INIT time only. ... This routine uses the corresponding function of the miniFSD , not normal file I/O, thus access is restricted. ... Although the size argument of the data structure implies, I'd recommend to better not read more than 32K at a time. ... DL = 044h This function will return the table of security helper functions for file access. ...

Еще в разделе: (Показать все результаты (>11648) - crydee.sai.msu.ru/ )

• Dynamic HTML in Communicator
• Heliophysics, Internal structure and seismology

... About Trac . ... Tickets . ... Email Notification of Ticket Changes . ... Set to __ default __ by default . always_notify_reporter : Always send notifications to any address in the reporter field ( default : false). always_notify_owner : ( since 0.9 ) Always send notifications to the address in the owner field ( default : false). always_notify_updater : ( since 0.10 ) Always send a notification to the updater of a ticket ( ... Some SMTP servers may reject the notification email sent by Trac. ...

Еще в разделе: (Показать все результаты (>3273) - kodomo.cmm.msu.ru/ )

• TracEnvironment тАУ Tanchiki
• WikiProcessors тАУ Tanchiki

... Sinergetic has recommended itself in the most various areas: to physics, chemistry, biology, and even in public sciences. ... The purpose of research was the study of laws of heat transfer process in active environment, which is nonequilibrium and itself can give the contribution to change of temperature. ...

Еще в разделе: (Показать все результаты (>270) - www.mce.biophys.msu.ru/ )

This is a subscription service to be automatically notified by e-mail when topics change in this _default web. ... Users subscribe to email notifications using their WikiName or an alternative email address, and can specify the webs/topics they wish to track. ... IT:admins' : Web* . A user may be listed many times in the WebNotify topic. ... A subscriber identified by an email address alone will only be sent change notifications if the topic they are subscribed to is readable by guest users. ...

Еще в разделе: (Показать все результаты (>7720) - wiki.cmc.msu.ru/ )

• WebNotify < PracticumV < Foswiki
• WebNotify < Practicum < Foswiki
• WebNotify < Main < Foswiki

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>233) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• screening by keywords
• Лаборатория регуляции белкового синтеза

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

... The LanHEP input file is the sequence of statements, each starts with a special identifier (such as parameter, lterm etc) and ends with the full-stop ' . ... This section is aimed to clarify the syntax of LanHEP input files, i.e. the structure of the statements. ... Let us consider the LanHEP input files for the Standard Model with both the t'Hooft-Feynman and unitary gauges. ... LanHEP allows the user to define several keys , and use these keys to branch among several variants of the model. ...

Еще в разделе: (Показать все результаты (>2230) - theory.sinp.msu.ru/ )

• The genEvents command
• Splitting the vertices with 4 colored particles
• Reduce program

PROTOCOL OF THE BUSINESS MEETING OF THE COMMISSION ON PALEOPEDOLOGY AT THE IV INTERNATIONAL SYMPOSIUM AND FIELD WORKSHOP ON PALEOPEDOLOGY ?PALEOSOLS AND CLIMATIC CHANGE? (July 28 and 30, Lanzhou, P.R. China) . ... It will contain the list of abstracts of the symposium in Lanzhou and some announcements regarding the INQUA Congress in Durban, S.A. NL 12 (May 1996) contains e.g. a detailed report of the Business Meeting of the PP - Commission at the last INQUA Congress 1995 in Berlin. ...

Еще в разделе: (Показать все результаты (>199) - www.fadr.msu.ru/ )

• PROTOCOL of Paleopedology Commission Business Meeting at V International