... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>1495) - oit.cmc.msu.ru/ )

... About Trac . ... Trac uses a directory structure and a database for storing project data. ... A new Trac environment is created using trac-admin : $ trac-admin /path/to/myproject initenv . ... For example, to connect to a PostgreSQL database on the same machine called trac , that allows access to the user johndoe with the password letmein , use: postgres://johndoe:letmein@localhost/trac . ... Note: don't confuse a Trac environment directory with the source code repository directory. ...

Еще в разделе: (Показать все результаты (>5982) - kodomo.cmm.msu.ru/ )

• TracBrowser тАУ Tanchiki

... The normal directory layout consists of a single top-level directory (The default name is /usr/src/redhat ), with five subdirectories. ... Contains the binary package files created by the build process. /usr/src/redhat/SRPMS ? ... ls -lF /usr/src/redhat total 5 drwxr-xr-x 3 root root 1024 Aug 5 13:12 BUILD/ drwxr-xr-x 3 root root 1024 Jul 17 17:51 RPMS/ drwxr-xr-x 4 root root 1024 Aug 4 22:31 SOURCES/ drwxr-xr-x 2 root root 1024 Aug 5 13:12 SPECS/ drwxr-xr-x 2 root root 1024 Aug 4 22:28 SRPMS/ # . ...

Еще в разделе: (Показать все результаты (>1991) - uneex.lorien.cs.msu.su/ )

• mod_vhost_alias - Apache HTTP Server
• mod_charset_lite - Apache HTTP Server
• mod_auth_anon - Apache HTTP Server

Additional topic data, program-generated or from TWikiForms , is stored embedded in the topic text using META: tags . ... Meta Data Syntax . Meta Data Specifications . ... META:FORM . ... By default, TWiki stores topics in files on disk, in a really simple and obvious directory structure. ... Order of fields within the meta variables is not defined, except that if there is a field with key name , this appears first for easier searching (note the order of the variables themselves is defined). ...

Еще в разделе: (Показать все результаты (>41764) - dualopt1.cmm.msu.ru/ )

Электронная библиотека Попечительского совета . ... Carter G. - LDAP System Administration . ... Название: LDAP System Administration . Автор: Carter G. Аннотация: . Explains how to centralize configuration information using LDAP, covering topics including access control, distributed directories, managing printers, interoperability, and scripting. ... access_attr parameter (rlm_ldap module) . ... browsers for LDAP . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>17344) - lib.mexmat.ru/ )

• Allen R., Richards J., Lowe-Norris A.G. - Active Directory :: Электронная
• Allen R., Lowe-Norris A.G. - Active Directory :: Электронная библиотека
• Foy B.D., Phoenix T., Schwartz R.L. - Learning Perl :: Электронная библиотека

To match any number of characters in a filename: ls *.txt . This lists all the files in the current directory that have the extension .txt - so Help.txt as well as nonsense.txt would be listed. To match any single character in a filename: cat memo? > mymemos . ... This removes files part1 , part2 and part3 from the current directory. If no files are found that match these names the message No match . ... To look for an expression in a file: grep '[Jj]ohn' < addresses . ...

Еще в разделе: (Показать все результаты (>696) - comet.sai.msu.ru/ )

• Examples of using cp with special characters
• Example of using anonymous ftp
• Example of comparing directories with the diff command

... Apache HTTP Server Version 2.0 . ... For example, the following configuration will map /cgi-bin/script.pl to /usr/local/apache2/cgi-bin/script.pl in all cases: . ... A request for http://www.example.com/directory/file.html will be satisfied by the file /usr/local/apache/vhosts/www.example.com/directory/file.html . ... A request for http://www.domain.example.com/directory/file.html will be satisfied by the file /usr/local/apache/vhosts/example.com/d/o/m/domain/directory/file.html . ...

Еще в разделе: (Показать все результаты (>663) - itpm.msu.su/ )

• mod_charset_lite - Apache HTTP Server
• mod_auth_anon - Apache HTTP Server
• Per-user web directories - Apache HTTP Server

This module provides support for dynamically configured mass virtual hosting . ... Source File: mod_vhost_alias.c . ... For simple name-based virtual hosts you might use the following directives in your server configuration file: UseCanonicalName Off VirtualDocumentRoot /usr/local/apache/vhosts/%0 . A request for http://www.example.com/directory/file.html will be satisfied by the file /usr/local/apache/vhosts/www.example.com/directory/file.html . ... Module: mod_vhost_alias . ...

Еще в разделе: (Показать все результаты (>124) - neptun.sai.msu.ru/ )

• Apache module mod_auth_anon.c
• Apache module mod_example
• Apache module mod_setenvif

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>7268) - mouse.belozersky.msu.ru/ )

• Example of alignment
• wLake program homepage

Network Working Group M. Smith Request for Comments: 2079 Netscape Communications Category: Standards Track January 1997 Definition of an X.500 Attribute Type and an Object Class to Hold Uniform Resource Identifiers (URIs) Status of this Memo This document specifies an Internet standards track protocol for the Internet community, and requests discussion and suggestions for improvements. ... URIs are widely used on the Internet, most notably within Hypertext Markup Language [2] documents. ...

Еще в разделе: (Показать все результаты (>52770) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc2079.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc775.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc775.txt

... This file is part of an example program for Qt. This example ** program may be used, distributed and modified without limitation. ** *****************************************************************************/ #ifndef DIRVIEW _H #define DIRVIEW _H # include qlistview.h # include qstring.h # include qfile.h class Directory : public QListViewItem { public: Directory ( QListView * parent ); Directory ( Directory * parent, const char * ...

Еще в разделе: (Показать все результаты (>747) - rtm-cs.sinp.msu.ru/ )

• Apache module mod_auth_anon.c
• Running the example
• Modules

... 4 from monomer import AminoAcidType . ... 21 * name -- str with the name of sequence . ... 44 def __init__ ( self , monomers = None , name = '' , description = "" ): . ... 102 def from_str ( fasta_str , name = '' , description = '' , monomer_kind = AminoAcidType ): . ... 191 def pdb_has ( self , chain , monomer ): . ... 194 def secstr_has ( self , chain , monomer ): . ... 198 def file_slice ( file , n_from , n_to , fasta_name = '' , name = '' , description = '' , monomer_kind = AminoAcidType ): . ...

Еще в разделе: (Показать все результаты (>59593) - kodomo.fbb.msu.ru/ )

• allpy: 835efa2a8c71 README.devel
• allpy: 88631907f23d allpy/pdb.py
• allpy: README.devel annotate

... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>604) - www.parallel.ru/ )

• Sample MPI programs | PARALLEL.RU - Информационно-аналитический центр по
• Running an MPI Program | PARALLEL.RU - Информационно-аналитический центр по
• Obtaining and Unpacking the Distribution | PARALLEL.RU -

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>254) - www.genebee.msu.ru/ )

• GeneBee service
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

... Minimal size of Clud clusters (residues) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Hydrophobic cluster of a single protein structure is a separated pool of nonpolar atoms. Usually there is the biggest cluster in the protein called hydrophobic core. ... ConClus program is able to detect of conservative hydrophobic clusters for a family of related protein domains or just for a set of aligned proteins. ...

Еще в разделе: (Показать все результаты (>32) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes
• Nhunt

... Algorithm & . Format requirements . Contact us . Gallery of examples . SDPsite was applied to 124 families fron the Pfam database . ...

Еще в разделе: (Показать все результаты (>146) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements
• SDPsite
• SDPsite - PF01026

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>7259) - monkey.belozersky.msu.ru/ )

• ETS numeration assumed
• HTH3_numeration_assumed
• SDP home page

... The LanHEP input file is the sequence of statements, each starts with a special identifier (such as parameter, lterm etc) and ends with the full-stop ' . ... This section is aimed to clarify the syntax of LanHEP input files, i.e. the structure of the statements. ... Let us consider the LanHEP input files for the Standard Model with both the t'Hooft-Feynman and unitary gauges. ... LanHEP allows the user to define several keys , and use these keys to branch among several variants of the model. ...

Еще в разделе: (Показать все результаты (>1179) - theory.sinp.msu.ru/ )

• fc3:dokuwiki:example [THEP]
• тЬО fc3:dokuwiki:example [THEP]
• Example: Summation of diagrams and symbolic integration by means of the Reduce

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>3) - tex.bog.msu.ru/ )

META:TOPICINFO{author="ProjectContributor" date="1299645271" format="1.1" version="1"}% %META:TOPICPARENT{name="ReferenceManual"}% %STARTINCLUDE% #MetaData ---+ Meta data _Additional data, Foswiki-generated or from [[DataForms][forms]], may be embedded in the topic text using =META:= macros_ %TOC% ---++ Overview The default store engines store topics in plain-text files on disk, in a simple and obvious directory structure. ... Format of this topic, will be used for automatic format conversion | ...

Еще в разделе: (Показать все результаты (>7960) - wiki.cmc.msu.ru/ )

• MetaData < System < Foswiki