Электронная библиотека Попечительского совета . ... Salomon D. - Data Compression: The Complete Reference . ... Название: Data Compression: The Complete Reference . ... Data compression is one of the most important fields and tools in modern computing. This third edition of "Data Compression" provides a comprehensive, authoritative, and accessible reference for the many different types and methods of compression. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>17402) - lib.mexmat.ru/ )

• Powell Th.A. - HTML XHTML: The Complete Reference :: Электронная библиотека
• Schildt H. - C++: The Complete Reference :: Электронная библиотека
• Salomon D., Bryant D. - Data Compression: The Complete Reference :: Электронная

... unknown) sesam_connect -- Open SESAM database connection . bool sesam_connect ( string catalog, string schema, string user) . Returns TRUE if a connection to the SESAM database was made, or FALSE on error. sesam_connect() establishes a connection to an SESAM database handler task. ... When creating a database, the "catalog" name is specified in the SESAM configuration directive //ADD-SQL-DATABASE-CATALOG-LIST ENTRY-1 = *CATALOG(CATALOG-NAME = catalogname,.. ... Connect to a SESAM database . ...

Еще в разделе: (Показать все результаты (>2213) - oit.cmc.msu.ru/ )

• Definitions of terms used to describe Apache directives
• ldap_parse_reference
• ldap_next_reference

. This diagram illustrates the relationship between the reference pixel and device pixels (called "dots" below). The image depicts a high resolution (large dot density) laser printer output on the left and a low resolution monitor screen on the right. For the laser printer, one square reference pixel is implemented by 16 dots. For the monitor screen, one square reference pixel is implemented by a single dot. Return to image.

Еще в разделе: (Показать все результаты (>5487) - crydee.sai.msu.ru/ )

• SGML reference information for HTML

... A regular expression (regex) is a powerful way of specifying a complex search. MySQL uses regular Henry Spencer's inplementation of regular expressions. ... MySQL uses the extended version. This is a simplistic reference that skips the details. To get more exact information, see Henry Spencer's regex(7) manual page that is included in the source distribution. ... A regular expression describes a set of strings. The simplest regexp is one that has no special characters in it. ...

Еще в разделе: (Показать все результаты (>630) - itpm.msu.su/ )

• perchild - Apache HTTP Server
• mod_imap - Apache HTTP Server
• mod_cache - Apache HTTP Server

... EM_PRO:AE004439 . ... Pm70, complete genome. ... EM_PRO:CP000671 . ... Salmonella enterica subsp. enterica serovar Schwarzengrund str. ... Salmonella enterica subsp. arizonae serovar 62:z4,z23:--, complete genome. 4600800 . ... Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594, complete genome. 4833080 . ... Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 complete genome . ... Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome. 4791961 . ...

Еще в разделе: (Показать все результаты (>3321) - kodomo.cmm.msu.ru/ )

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... TWikiDocumentation 30 - 2001-09-07 - MikeMannix . ... Changed: . ... This page contains all documentation topics as one long and complete reference sheet. ... Doubleclick anywhere on-screen to return to the top of the page. This page contains all documentation topics as one long, complete reference sheet. ... You can also browse the TWiki reference as individual pages from the full topics menu .) ...

Еще в разделе: (Показать все результаты (>40600) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (15 vs. 19) - TWiki
• %TOPICTITLE% (1 vs. 2) - TWiki
• %TOPICTITLE% (22 vs. 23) - TWiki

... News . ... The major part of the course is dedicated to the studying measuring devices and units for data collection and processing, re-engineering of unknown circuits. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ... Working on a course project: testing of a board or a device with unknown malfunctioning, faultfinding and debugging, demonstration of the functioning device. ... 2013-2015 Engineering Physics Laboratory...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Introduction to Linux
• Parallel Programming
• FPGA Design

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>110) - classic.chem.msu.su/ )

• PC GAMESS vs. WinGamess performance comparison
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

... 15, 1972 Update on SMFS Login and Logout This document replaces RFC 399, which introduced the Login and Logout commands for UCSB's SMFS, but was incomplete. ... Login (LGI) The Login command is the means whereby the user identifies himself and specifies the account number to which his use of SMFS is to be billed. ... The user name and account number specified remain in effect until another LGI command is issued, a LGO command is issued, or the connection is close. ...

Еще в разделе: (Показать все результаты (>48801) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc431.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc399.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc399.txt.pdf

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>57) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => NSR Search Engine
• CDFE => Online Services => Relational ENSDF

Description and Technical Details . In 1980s two medium-size horizontal solar telescopes 50/35000 cm with large spectrographs Czerny-Turner made by Carl Zeiss Jena were installed in the Ond?ejov observatory. The Czerny-Turner-spectrographs in the Ond?ejov observatory called HSFA1 and HSFA2 according to the German name Horizontal-Sonnen-Forschungs-Anlage ("horizontal device for solar research") have been explored for more than two decades. ... Diffraction grating - Richardson, Spectra-Physics . ...

Еще в разделе: (Показать все результаты (>407) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Data bases of Natural Satellites. Documentation. Sources

... About lab . ... Roadway video passport systems are widely-used for detailed road mapping which allows roadway quality monitoring and repair planning. ... Typical roadway images are strongly differed to each other in colors and texture, some examples are shown below. ... When preprocessing is completed our algorithm is trained on a part of rectified road image with the help of user input. ... We take advantage of image segments classification for object detection on road images. ... Source image . ...

Еще в разделе: (Показать все результаты (>211) - graphics.cs.msu.ru/ )

• Road monitoring | Лаборатория компьютерной графики и мультимедиа
• Short Reference Image Quality Estimation Using Modified Angular Edge Coherence
• GML AdaBoost Matlab Toolbox | Лаборатория компьютерной графики и мультимедиа

... Problems and tasks of the research programme< . ... Laboratory-chair of modelling the natural references of time . ... To indicate the natural references of time and to discuss the consequences of their existence is one of the important tasks of the research programme suggested. ... The equations of motion, representing the basic content of a dynamical theory, are actually a description of the variability objects of interest for the researcher as compared with reference variability (the clocks). ...

Еще в разделе: (Показать все результаты (>435) - chronos.msu.ru/ )

... The following entity names are used in HTML, always prefixed by ampersand (&) and followed by a semicolon as shown. ... Name Syntax Description Aacute Aacute; Capital A, acute accent Agrave Agrave; Capital A, grave accent Acirc Acirc; Capital A, circumflex accent Atilde Atilde; Capital A, tilde Aring Aring; Capital A, ring Auml Auml; Capital A, dieresis or umlaut mark AElig AElig; Capital AE dipthong (ligature) Ccedil Ccedil; Capital C, cedilla Eacute Eacute; ...

Еще в разделе: (Показать все результаты (>179) - comet.sai.msu.ru/ )

• Using UNIX commands
• Look-up Online Manual
• Index: C

This module provides for server-side imagemap processing. ... Configurable generation of imagemap menus. The lines in the imagemap files can have one of several formats: directive value [x,y ...] . ... The directives can come in any order, but are processed in the order they are found in the imagemap file. base Directive . ... Module: mod_imap . ... Its value is overridden by a default directive within the imagemap file. ... Its value is overridden by a base directive within the imagemap file. ...

Еще в разделе: (Показать все результаты (>128) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache directives
• Server-Wide Configuration
• Apache module mod_log_referer

... Method Detail protected final void init ( ConcreteIndexMap.ZZMap iMap, ConcreteIndexMap.ZZMap lengthsMap) . ... iMap - ZZMap defining the forward transform. protected final void link ( ConcreteIndexMap prev, ConcreteIndexMap.ZZMap iMap, ConcreteIndexMap.ZZMap lengthsMap) . ... prev - ConcreteIndexMap this is composed with. iMap - ZZMap defining the forward transform. lengthsMap - ZZMap defining the reverse transform. protected final void link ( ConcreteIndexMap prev, ConcreteIndexMap.ZZMap iMap) . ...

Еще в разделе: (Показать все результаты (>97) - angel.cs.msu.su/ )

• : Class NetcdfRemoteProxyImpl
• : Package ucar.multiarray

... Mon, 24 Jan 2011 22:01:21 +0300 . ... Fri, 21 Jan 2011 15:28:26 +0300 . Daniil Alexeyevsky . ... Thu, 20 Jan 2011 22:31:37 +0300 . ... Fri, 17 Dec 2010 16:36:00 +0300 . ... Trivial fixes in allpy.base.Block . ... Thu, 16 Dec 2010 23:45:57 +0300 . ... Fixed module imports of allpy.base . ... Wed, 15 Dec 2010 23:45:11 +0300 . ... Tue, 14 Dec 2010 21:06:42 +0300 . ... Moved contents of block.py to base.py without any changes. ... Sat, 04 Dec 2010 00:19:17 +0300 . ... allpy: add base.py 1.1.0 . ...

Еще в разделе: (Показать все результаты (>18333) - kodomo.fbb.msu.ru/ )

• allpy: log
• allpy: allpy/rna.py history
• allpy: allpy/dna.py history

О лаборатории . ... Лаборатория теоретической биофизики . ... On this page we collect references to our resources, documentation and resources on other sites. All these data are very helpful for everybody who wants to learn practical quantum chemistry. Firefly (PC GAMESS) main page . ... ERG group wrote some articles about visualization: . ... Нет комментариев " Quantum chemistry information page " . ... Quantum chemistry information page . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>34) - erg.biophys.msu.ru/ )

... Reduction of detailed schemes for chemical transformations of formaldehyde and hydrogen oxidation reactions based on a sensitivity analysis of a mathematical model" . ... The results of simulation are compared in the case of using a number of reduced and detailed schemes for formaldehyde and hydrogen oxidation reactions. Keywords: sensitivity analysis, mathematical model of reaction, formaldehyde oxidation reaction, hydrogen oxidation reaction, reduction of chemical reaction mechanisms. ...

Еще в разделе: (Показать все результаты (>287) - num-meth.srcc.msu.ru/ )

• "Automatic detection and description of supercomputer network infrastructure"
• Domain decomposition based on a direct method for solving the three-dimensional

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out