... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>5676) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~golikov_v/practices/aj223173.out
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>31913) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~ogion/projects/Evolution_of_sequences/hemn_yp.blast

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>35) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4910) - cdfe.sinp.msu.ru/ )

c-tree Plus(r) File Handler . Based on advanced B+tree (balanced) algorithm, c-tree Plus API handles all aspects of database I/O. Users select low-level or high-level ISAM routines for random/ sequential access. ... Program single user or multi-user non-server applications royalty free and migrate existing c-tree Plus applications to the FairCom server by recompiling. ... http://www.faircom.com/product_tech/ctree/c-tree.html . ... http://www.faircom.com/ . ... SAL Home | ... Utilities Other DBMS . ...

Еще в разделе: (Показать все результаты (>2329) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS - Oracle Products
• SAL- Database Systems - Object-Oriented DBMS - ROL
• SAL- Database Systems - Utilities Other DBMS - barracuda

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>200) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services Help
• BLAST Frequently Asked Questions (FAQ)

Электронная библиотека Попечительского совета . ... Loney K. - Oracle Database 10g: The Complete Reference . ... Название: Oracle Database 10g: The Complete Reference . Автор: Loney K. Аннотация: . Get a thorough understanding of Oracle Database 10g from the most comprehensive Oracle database reference on the market, published by Oracle Press. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>11261) - lib.mexmat.ru/ )

• Mullins C.S. - Database Administration: The Complete Guide to Practices and
• Loney K., Koch G. - Oracle8i: The Complete Reference :: Электронная библиотека
• Andersen V. - Microsoft Office Access 2007: The Complete Reference ::

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>5941) - monkey.belozersky.msu.ru/ )

PLTT DISCLAIMER: The PLTT makes no claims of ownership on the copyrighted works of O(+>, the artist formerly known as Prince, aka Prince Rogers Nelson. ... The PLTT, completely through voluntary work, hopes to provide the most comprehensive database of lyrics for the known works of this artist. ... We hope you enjoy our efforts, and contribute by making errors and opinions known to the PLTT by sending mail to pltt@umich.edu. (c) Copyright 1999 Prince Lyric Transcription Team ...

Еще в разделе: (Показать все результаты (>2754) - crydee.sai.msu.ru/ )

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>610) - oit.cmc.msu.ru/ )

• Security
• dBase functions

Next: Delivering Messages to Local Up: Routing Messages Previous: Routing Messages . smail expects to find the pathalias database in the paths file below /usr/lib/smail. This file is optional, so if you don't want to perform any pathalias routing at all, simply remove any existing paths file. paths must be a sorted ASCII file that contains entries which map destination site names to UUCP bang paths. The file has to be sorted because smail uses a binary search for looking up a site. ...

Еще в разделе: (Показать все результаты (>329) - itpm.msu.su/ )

• Dialing out with chat

... intas:cern-intas03:task2 ]] . ... T2.GRID monitor.. ... User Policy . ... GRID monitoring tools . ... Creation of a tool providing users with access to detailed application information in the framework of the GRID paradigm and test it in LCG. ... Development of monitoring tools that produce integrated characteristics by use of statistical information gathered from various GRID elements. ... However, the delivery of such specific information to users through the GRID is not possible in existing GRIDs...

Еще в разделе: (Показать все результаты (>639) - theory.sinp.msu.ru/ )

• тЬО intas:cern-intas03:task2 [THEP]
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,
• [RU-NGI] mysql dpm под UMD-3 : не удаётся восстановить данные

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6965) - mouse.belozersky.msu.ru/ )

• S : rm_systems

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>31) - seac47-2.phys.msu.ru/ )

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>2) - ecoinformatica.srcc.msu.ru/ )

... Non-destructive Test of status . ... This call is useful for accessing the information associated with a request, without freeing the request (in case the user is expected to access it later). ... MPI_REQUEST_GET_STATUS( request, flag, status ) . ... int MPI_Request_get_status(MPI_Request request, int *flag, MPI_Status *status) . MPI_REQUEST_GET_STATUS( REQUEST, FLAG, STATUS, IERROR) . ... Sets flag=true if the operation is complete, and, if so, returns in status the request status. ... Центры . ...

Еще в разделе: (Показать все результаты (>495) - www.parallel.ru/ )

• MPI_Cancel | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Progress | PARALLEL.RU - Информационно-аналитический центр по параллельным

The database of triplet periodicity change points Y.M. Suvorova, E.V. Korotkov Centre of Bioengineering Russian Academy of Sciences, 117312, prospect 60 -tya Oktyabrya 7/1, Moscow, Russia, suvorovay@gmail.com It is well-known that triplet periodicit y (TP) is the dist inguishing feature of protein coding sequences of the majorit y of the living organisms [1]. ... The current version o f the database includes 179 238 records of protein coding sequences with triplet periodicit y change points. ...

Еще в разделе: (Показать все результаты (>304) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/162.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/100.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/78.pdf

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>133) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.
• Russian SETI

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>325) - xray.sai.msu.ru/ )

• Be/X-ray binaries and candidates
• AXAF-Chandra
• Links to Databases