... Balch M. - Complete Digital Design: A Comprehensive Guide to Digital Electronics and Computer System Architecture . ... Название: Complete Digital Design: A Comprehensive Guide to Digital Electronics and Computer System Architecture . Автор: Balch M. Аннотация: . Guide to understanding and navigating the interlocking components, architectures, and practices necessary to design and implement digital systems. ...

Еще в разделе: (Показать все результаты (>114080) - lib.mexmat.ru/ )

• Piattini M., Diaz O. - Advanced Database Technology and Design :: Электронная
• Lightstone S.S., Teorey T.J., Nadeau T. - Physical Database Design: The
• Mullins C.S. - Database Administration: The Complete Guide to Practices and

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>200) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Sources

DBGUI . DBGUI is a complete Sybase database graphical interface for X. DBGUI is designed to be an easy interface for performing any SQL commands. DBGUI saves a TON of typing by maintaining a lengthy history of each and all command parameters. ... Home Site: . http://home.swbell.net/mscroggi/dbgui/dbgui.html . ... None . ... User Comments: . ... SAL Home | Database Systems | Relational DBMS . Comments? SAL@KachinaTech.COM . Copyright 1995-2001 by Herng-Jeng Jou . ...

Еще в разделе: (Показать все результаты (>3542) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS
• SAL- Database Systems - Relational DBMS - ADABAS D
• SAL- Database Systems - Utilities Other DBMS - c-tree Plus

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>84) - electr003.chem.msu.ru/ )

... Version: $Id: html-design.html,v 1.15 1994/11/26 19:53:43 connolly Exp $ . ... The HTML 2.0 Specification Review materials includes complete information on the HTML Working group of the IETF, the discussion of the HTML 2.0 specification, mailing list archive, and other supporting materials. ... JHU/APL's WWW HTML Developer's JumpStation - Page 1 . ... Gentle Introduction to SGML from the TEI guidelines. www-talk . ... There is also a hypertext archive. ... IETF Working group for HTML. www-html . ...

Еще в разделе: (Показать все результаты (>4496) - crydee.sai.msu.ru/ )

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>902) - oit.cmc.msu.ru/ )

... Line: 1 to 1 . Welcome to TWiki, a web-based collaboration tool, document management tool, and knowledge base tool. ... Changed: . Complete documentation for Webmasters, system administrators, anyone interested in installing and fine-tuning a TWiki site. ... TWikiVariables . ... A collection of single-page topics: clear, concise how-to guides designed for busy TWiki users. ... TWikiVariables : Manipulate text, graphics, calculations, and more with simple expanding text strings. ...

Еще в разделе: (Показать все результаты (>39125) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (14 vs. 18) - TWiki
• TWikiAttrsDotPm - TWiki - TWiki
• %TOPICTITLE% (17 vs. 21) - TWiki

... This project is designed to provide students with first-hand experience in intercultural communication with their peers from another culture (country) using the most advanced electronic communivation technologies. б Specifically, students will work together in small groups comprised of MSU and Geneseo students to meet a challenge of collaborative project. ... Administrator: Mira Bergelson . Administrator: Corey Ha . Teacher: Mira Bergelson . Teacher: Corey Ha . ...

Еще в разделе: (Показать все результаты (>10567) - moodle.ffl.msu.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4918) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE provides the major photonuclear databases. Online Services.

... intas:cern-intas03:task2 ]] . ... T2.GRID monitor.. ... User Policy . ... GRID monitoring tools . ... Creation of a tool providing users with access to detailed application information in the framework of the GRID paradigm and test it in LCG. ... Development of monitoring tools that produce integrated characteristics by use of statistical information gathered from various GRID elements. ... However, the delivery of such specific information to users through the GRID is not possible in existing GRIDs...

Еще в разделе: (Показать все результаты (>1873) - theory.sinp.msu.ru/ )

• тЬО intas:cern-intas03:task2 [THEP]
• spamassassin - extensible email filter used to identify spam
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,

... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... The BLAST 2.0 search engine has been designed for optimal speed and sensitivity. ... Gapped BLAST and PSI-BLAST are useful search tools provided by the BLAST server (version 2.0) (Altschul et al., ... You can download blastcl3 form the anonymous FTP location ftp://ncbi.nlm.nih.gov/blast/network/netblast/ . ...

Еще в разделе: (Показать все результаты (>212) - www.genebee.msu.ru/ )

• Databases
• BLAST Frequently Asked Questions (FAQ)
• Genebee Advanced BLAST 2.0

... The University Information System RUSSIA (UIS RUSSIA) has been designed and is maintained as a corporate digital library for research and education in economics and social sciences. ... The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>161) - srcc.msu.ru/ )

• Научно-исследовательский вычислительный центр МГУ
• E. Katkova Docking and postprocessing: application to design of urokinase
• Leading scientific fellow Sergey Piskarev Ph.D.

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>71) - smdc.sinp.msu.ru/ )

• NUCLEON Experiment

LINEAL: an electronic encyclopedia in linear algebra" . V.V. Voevodin and Vl.V. Voevodin . This paper is devoted to an information system designed for the usage in Internet and for the operation with problem-oriented databases in those branches of science where the cause-and-effect relations are of prime importance. Linear algebra is taken as an example for presentation of the system. ... PostScript (in Russian) (28MB) . ... V.V. Voevodin and Vl.V. Voevodin e-mail: voevodin@parallel.ru ...

Еще в разделе: (Показать все результаты (>208) - num-meth.srcc.msu.ru/ )

• "A hybrid database (information system) on the molecular spectral constants"
• "Software architecture modeling"

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2800) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... FPGA design, architecture, means and methods of work. ... FPGA stands for Field-Programmable Gate Array, which is a semi-conductive crystal, the connections between gates of which and the logic of work can be modeled and changed repeatedly during its work. ... Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ... In spring semester students have 44 hours to work on their term papers on design and then 4 hours for defending...

Еще в разделе: (Показать все результаты (>81) - engineering.phys.msu.ru/ )

• Noise Meter
• Circuit Diagnostics
• Introduction to Linux

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>29) - seac47-2.phys.msu.ru/ )

• Pre-registration and abstract submission form

... Documentation . Up: Contents Next: Configuring
 mpich
 Previous: Obtaining and Unpacking the Distribution . This distribution of mpich comes with complete man pages for the MPI routines, the MPE extensions, and the ADI (Abstract Device Interface) routines. ... The mpich/ref directory contains printable versions of the man pages for MPI and the ADI, in compressed PostScript form. The mpich/doc directory contains this Installation Guide and also the User's Guide . ... Центры . ...

Еще в разделе: (Показать все результаты (>602) - www.parallel.ru/ )

• Return status | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Overview | PARALLEL.RU - Информационно-аналитический центр по параллельным

. Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . Описание проблемы: . Введите почтовый адрес: . Войти в систему . Регистрация . Главная . Поиск . Статистика . О проекте . Помощь . Издательство: Springer-Verlag . Местоположение издательства: Heidelberg, Germany . ї 2011-2015 НИИ механики МГУ . Лаборатория 404. Все права защищены. обратная связь . Создать

Еще в разделе: (Показать все результаты (>4136) - istina.msu.ru/ )

• Advances in Polymer Science - журнал | ИСТИНА - Интеллектуальная Система
• Lohmann B. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Designed Monomers and Polymers - журнал | ИСТИНА - Интеллектуальная Система