... Активные темы Список участников Поиск по форуму Помощь . ... Тема: look at shades designed to . ... Gaga title are frequently will show up to the modern day art media, the <a href=http://www.discountedsunglassesonline.net/#338>cheap oakley usa</a> last time she appeared simply because at MTV Gaga attend the occasion will be the id of polaroid inventive director, this pair of sun shades are identified as GL20, it can choose photos and online video, and might take in eyeglasses lens screen. ...

Еще в разделе: (Показать все результаты (>7365) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: They?re very design in advance
• Экологический Форум - Фундаментальная Экология: i just completed a whole
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News:

... maxdepth 1 -type f -name "*.${1}"` do dobin $i || die "dobin $i failed" done ;; "sty" | ... in_iuse doc || use doc ; then for i in `find . ... maxdepth 1 -type f - name *.bst ` do insinto ${TEXMF}/bibtex/bst/${PN} doins $i || die doins $i failed done ;; styles ) latex-package_src_doinstall sty cls fd clo def cfg bst ;; doc ) latex-package_src_doinstall tex dtx dvi ps pdf ;; fonts ) latex-package_src_doinstall tfm vf afm pfb ttf ;; bin ) latex-package_src_doinstall ...

Еще в разделе: (Показать все результаты (>21661) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/sci-electronics/electric/electric-8.09.ebuild
• http://mirror.msu.net/pub/gentoo-portage/metadata/news/2014-11-25-bash-completion-2_1-r90/2014-11-25-bash-completion-2_1-r90.en.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/fyi/fyi1.txt

SAMSUNG Electronics Co., ... Peculiarities of Android OS , , / / , , , (Smart TV, Digital TV, IP TV, Embedded SW, System Programming, Android Platform , Messaging, SMART Phone, PCB Design , Noise Avoidance Design , Circuit Design , Multimedia Framework, Streaming (RTP / RTSP / HTTP), OpenMax / OMXIL(Codec / Muxer / Demuxer), Radio Interface Layer, GPS in Android Platform , C/C++, MFC, Linux , Java, Digital Signal · · Processing [DSP], Embedded Linux Core / File ...

Еще в разделе: (Показать все результаты (>125) - www.msu.ru/ )

Modules | ... Apache HTTP Server Version 2.0 . ... Provides for user authentication using DBM files . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... Combining Group and Password DBM files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>645) - itpm.msu.su/ )

• The paths database
• Pathalias and Map File Format
• What is a Mail Message?

Modules | ... Apache HTTP Server Version 2.0 . ... Provides for user authentication using DBM files . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... Combining Group and Password DBM files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>834) - uneex.lorien.cs.msu.su/ )

• htdbm - Manipulate DBM password databases - Apache HTTP Server
• Package Management: How to Do It?
• Using RPM to Verify Installed Packages

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>16197) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: cc1959669928 allpy/markup.py

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>77) - mouse.belozersky.msu.ru/ )

• S : rm_systems

Backlinks to CommandAndCGIScripts in all Webs ( Search System Web only ) . ... A List of Wiki Administrator Documentation $ AccessControl : Restricting read and write access to topics and webs, by users and groups $ TopicUserMappingContrib .. NEW - 22 Nov 2010 - 01:48 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... Number of topics: 18 . ...

Еще в разделе: (Показать все результаты (>10948) - wiki.cmc.msu.ru/ )

• (backlinks in System Web) CommandAndCGIScripts < System < Foswiki
• (backlinks in all Webs) DataForms < System < Foswiki
• (backlinks in System Web) DataForms < System < Foswiki

Backlinks to CommandAndCGIScripts in System Web ( Search all webs ) . ... A List of Wiki Administrator Documentation $ AccessControl : Restricting read and write access to topics and webs, by users and groups $ TopicUserMappingContrib .. NEW - 22 Nov 2010 - 01:48 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... Number of topics: 18 . ...

Еще в разделе: (Показать все результаты (>7325) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) DataForms < System < Foswiki
• (backlinks in System Web) DataForms < System < Foswiki
• (backlinks in System Web) TemplateTopics < System < Foswiki

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>214) - elana.sinp.msu.ru/ )

• michael kors outlet uk This makes a rather convincing case for the
• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

Starting from the PC GAMESS version 6.3, the support of the new proprietary parallel mode communication interface (which is called P2P interface) was implemented as the part of PC GAMESS. ... The PC GAMESS/Firefly specific parallel MP2 energy and energy gradient method=1 modules supports P2P communication model. ... The dynamic library in which the P2P interface is implemented. ... Starting from the PC GAMESS v. 6.4, the DLB (dynamic load balancing) functionality was added to P2P interface. ...

Еще в разделе: (Показать все результаты (>94) - classic.chem.msu.su/ )

• Firefly Home Page
• Firefly DOCUMENTATION - command line arguments
• PC GAMESS/Firefly DOCUMENTATION - FAST MATRIX DIAGONALIZATION AND INVERSION

... Полная версия этой страницы: Работа в Samsung Electronics для математиков и программистов . Студенческий форум Физфака МГУ > Общий > Работа . Samsung_ . ... Работа в компании Samsung Electronics . Samsung Electronics объявляет набор технических специалистов (математиков, программистов, инженеров), заинтересованных в научно-исследовательской работе в исследовательских центрах компании, а также специалистов в области маркетинга и экономики. ... Математика, информатика, программирование . ...

Еще в разделе: (Показать все результаты (>761) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > РАБОТА В SAMSUNG ELECTRONICS ДЛЯ ПРОГРАММИСТОВ
• РАБОТА В SAMSUNG ELECTRONICS ДЛЯ ПРОГРАММИСТОВ ПОД LINUX / JAVA [JVM] И
• Работа в Samsung Electronics для математиков и программистов - Студенческий

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>7) - npidb.belozersky.msu.ru/ )

... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>169) - sp.cs.msu.ru/ )

• Lib-DVM. Preliminary design
• Logic and Databases
• DVM debugger. Detailed design. Part 4

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>218) - graphics.cs.msu.ru/ )

• Grants and contracts | Graphics and Media Lab
• Advanced Concepts for Intelligent Vision Systems: 15th International
• Automatic building texture completion | Graphics and Media Lab

... Кадровый состав . Обучение на кафедре . ... Введение в квантовую физику . FAQ для студентов . Информация о курсовых 2 курса . О кафедре . ... 23 / декабря 2013 . В понедельник, 23 декабря 2013 г. в 10-00 в конференц-зале КНО состоятся защиты дипломных работ студентов кафедры. 16 / декабря 2013 . В понедельник, 16-го декабря, в конференц-зале КНО состоится очередное, 734-е, заседание научного семинара кафедры квантовой электроники. ... 2003 2016 Кафедра квантовой электроники . ...

Еще в разделе: (Показать все результаты (>46) - quantum.phys.msu.ru/ )

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>93) - sai.msu.ru/ )

• GCVS Query forms
• General Catalogue of Variable Stars: Description

... Natalya V. Raguzova and Sergei B. Popov . ... We present a compilative catalogue of Be/X-ray binaries and candidates in the Galaxy and in the Large and Small Magellanic Clouds. This catalogue contains 160 sources and provides information on names and spectral types of optical components, distances, on spin characteristics of neutron stars, and on orbital and X-ray properties of binary systems. ... Be/X-Ray Binaries and candidates in the Galaxy . Galactic sources: comments to the Table 1 . ...

Еще в разделе: (Показать все результаты (>489) - xray.sai.msu.ru/ )

• Introduction
• Welcome to X-Ray
• AXAF-Chandra