... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>32) - analyt.chem.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Throughout the pap er by a four-valent graph we mean the following generalization: a finite 1-complex with each connected comp onent b eing homeomorphic either to a circle or to a four-valent graph; by a vertex of a four-valent graph we mean only vertices of those comp onents which are homeomorphic to four-valent graphs, and by edges we mean b oth edges of four-valent graphs and circular comp onents (the latter will b e called cyclic edges). ... A free knot is a 1-comp onent free link. ...

Еще в разделе: (Показать все результаты (>43) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/koudr/publ.pdf
• http://dfgm.math.msu.su/files/papers-sym/conder.pdf
• Носовский Г.В. / Кафедра Дифференциальной геометрии и приложений /

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Full-time programs . ... Partners . ... All partners . ... Attraction of international students, development of cooperation with foreign partner universities is one of the priorities for the Faculty of Journalism. ... Foreign citizens can enter the Faculty of Journalism on a contract basis according to specific rules. ... Faculty of Journalism provides foreign applicants with a standard visa invitation. ...

Еще в разделе: (Показать все результаты (>41) - www.journ.msu.ru/ )

• The round table ?Problems of regional television in Russia? :: Department of

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomasґ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

Support ] [ Links to DC resistivity and IP software in WWW ] . ... TRF_2D for Windows - Automated 2D Inversion Program for VES Travers Data. ... The scientists of the laboratory are developing algorithms and computer programs for decision of forward and inverse problems of resistivity and induced polarization methods, which are widely known in Russia and are applied in many countries abroad. ... IE2DL - the set of the programs for resistivity and IP data modeling in 2D inhomogeneous media . ...

Еще в разделе: (Показать все результаты (>53) - geophys.geol.msu.ru/ )

• Anis. Page2
• Near-surface electrical prospecting laboratory at Moscow University
• Researchs

... TEX METAFONT , TEX - . ... TEX; Internet ftp://sunsite.unc.edu/pub/academic/russianstudies/Software/PSfonts/pscyr.tar.gz. ... AcademyPSCyr), Regular , Bold , Italic Ї (HandbookPSCyr), Regular , Bold , Italic Ї (CollegePSCyr), Regular , Bold , Italic Ї (AntiquaPSCyr), Regular , Bold , Italic Ї (Lazurski), Regular Ї (TimesNewRomanPSMT), Regular , Bold , Italic , Bold Italic : Ї (ArialMT), Regular , Bold , Italic , Bold Italic , Black Ї (TextbookPSCyr), Regular , Bold ,...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>14) - temporology.bio.msu.ru/ )

... Предыдущее сообщение: PARALLEL.RU - Новости, специальный выпуск [16/11/2010] . ... Выпуск 298 . 23 ноября 2010 г. ------------- 1 декабря 2010 заканчивается срок представления аннотаций докладов на Международную научную конференцию Параллельные вычислительные технологии (ПаВТ) 2011 . http ://agora.guru.ru/pavt ------------- На странице Научного семинара PARALLEL.RU выложены ссылки на видеозапись выступления Томаса Стерлинга в НИВЦ МГУ имени М.В.Ломоносова 1 ноября 2010 года ...

Еще в разделе: (Показать все результаты (>112) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #389 [21/07/2015]
• PARALLEL.RU - Новости, выпуск #268 [07/07/2009]
• PARALLEL.RU - Новости, выпуск #284 [06/04/2010]

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>9) - td.chem.msu.ru/ )

• Lora S. Nikolaeva Laboratory of Chemical Thermodynamics
• Colloquium on 10.04.08 Laboratory of Chemical Thermodynamics

... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...

Еще в разделе: (Показать все результаты (>12) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%203.pdf

... Many presentations concern interesting work, but are nevertheless difficult to follow because the speaker unknowingly makes a number of presentation errors. ... Time 1 Conclusion Audience Attention Introduction Various Themes Efficient Presentation Intermediate Conclusion Intermediate Conclusion Average Presentation Figure 2 Ideal attention curve of an audience when the speaker divides his talk in recognizable parts, each summarized by intermediate conclusions. ... What is a successful poster? ...

Еще в разделе: (Показать все результаты (>26) - www.kge.msu.ru/ )

• Дипломные работы
• Публикации
• Chemistry Journals

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - hpc.cs.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ TSUNAMIGENIC POTENTIAL OF SUBMARINE EARTHQUAKES IN DIFFERENT REGIONS IN THE PACIFIC Viacheslav K. Gusiakov Institute of Computational Mathematics and Mathematical Geophysics, Siberian Division, Russian Academy of ... Fig. 1 shows the positions of 10 main tsunamigenic regions in the Pacific. ...

Еще в разделе: (Показать все результаты (>32) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E01_Armigliato.pdf
• http://seac47-2.phys.msu.ru/proc/E22_Watts.pdf
• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ґ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>15) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2016/InfoMessageEng2.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/perl.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc

... International Olympiad Б€?Nanotechnologies Б€? Breakthrough to the Future!Б€? . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies Б€?Nanotechnologies Б€? Breakthrough to the Future!Б€? . ...

Еще в разделе: (Показать все результаты (>2) - www.fnm.msu.ru/ )

• About

The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>13) - acm.msu.ru/ )

• Create user account [Комиссия, 3 семестр, 2014-2015]
• Create user account [Комиссия, 4 семестр, 2014-2015]
• Create user account [ACM ICPC 2015-2016, NEERC, Moscow Subregion, Training]