... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>11) - lcc.chem.msu.ru/ )

• Current Projects

Unfaithful embedding of causal sets arXiv:1006.2320v1 [physics.gen-ph] 10 Jun 2010 Alexey L. Krugly Abstract In the causal set approach, spacetime is a continuous approximation of a faithful emb edded causal set. But the faithful emb edded causal set describ es the empty spacetime and cannot describ e matter. ... If we describe the elements of the faithfully embedded causal set as the vertices of the graph, and segments of the timelike curves as edges these vertices must have an infinite valency. ...

Еще в разделе: (Показать все результаты (>20) - temporology.bio.msu.ru/ )

• Institute Laboratory-Chairs
• Время и взаимодействие
• Уравнения динамики систем

Bifurcations of Equilibria in Potential Systems at Bimodal Critical Points Alexei A. Mailybaev e-mail: mailybaev@imec.msu.ru Alexander P. Seyranian e-mail: seyran@imec.msu.ru Institute of Mechanics, Moscow State Lomonosov University, Michurinsky prospect 1, 119192 Moscow, Russia Bifurcations of equilibria at bimodal branching points in potential systems are investigated. ... In this paper, we intend to give a complete theory of bimodal bifurcations in potential systems with symmetries. ...

Еще в разделе: (Показать все результаты (>27) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/SeyranianMailybaev2001.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2001b.pdf

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>211) - observ.pereplet.ru/ )

... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>10) - theorphys.phys.msu.ru/ )

• Кафедра теоретической физики физического факультета МГУ

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>10) - www.issp.ac.ru/ )

SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

• SINP MSU

Next] [Previous] [up] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . Permission is granted to make and distribute verbatim copies of this manual provided that the copyright notice and these paragraphs are preserved on all copies. ... The Unidata Program Center is managed by the University Corporation for Atmospheric Research and sponsored by the National Science Foundation. ... NetCDF User's Guide for C - 6 Nov 1997 . ...

Еще в разделе: (Показать все результаты (>25) - angel.cs.msu.su/ )

• Index

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>21) - td.chem.msu.ru/ )

• CpAppro Laboratory of Chemical Thermodynamics
• TernAPI program Laboratory of Chemical Thermodynamics

Conference on 'Reflections on the atomic nucleus', 28.06.2015, Liverpool, UK. This meeting, see http://ns.ph.liv.ac.uk/Reflections2015 , will touch upon a few sub-topics of current interest in nuclear structure physics including aspects of nuclear collectivity, strengths, shell evolution and super-heavy elements as well as sessions devoted to nuclear astrophysics, fundamental physics and new experimental probes. ... The conference fee is ?100. ...

Еще в разделе: (Показать все результаты (>5) - www.msu.dubna.ru/ )

Muller cells are living optical fibers Ё in the vertebrate retina Kristian Franze*, Jens Grosche*, Serguei N. Skatchkov, Stefan Schinkinger§, Christian Foja¶, Detlev Schild , Ortrud Uckermann*, ... California, Berkeley, CA, and accepted by the Editorial Board March 27, 2007 (received for review December 15, 2006) Although biological cells are mostly transparent, they are phase objects that differ in shape and refractive index ... 20 8287­ 8292 BIOPHYSICS Fig. ... Fig. ... Cell Isolation. ...

Еще в разделе: (Показать все результаты (>3) - cell.biophys.msu.ru/ )

• http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf

... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...

Еще в разделе: (Показать все результаты (>8) - geophys.srcc.msu.ru/ )

• http://geophys.srcc.msu.ru/library/parcfd2003.pdf
• http://geophys.srcc.msu.ru/library/zilitinkevich_et_al.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

... 1989, .. 400 , 5 , « » (1987) . ... 1983 . ... 1983 , , 1981 , (1991). ... 1998 ., , , , 30 « ». 1968 . 1998 . ... 1974 .; , 1977 .; , 1981 .; , 1988 .). ( , ), . 1988 , ­ , . ... 1983 , , , «». 1983 ., , .. . ... 1986 . ... 1989 .) « » (1990 .). -. , .. .. , ­ . ... 1997 « ». (1999 .). .. , , , , , . ... 13 - 1999 ­ 5 . ... 234-235. 1986. (o-authors N.L.Smirnova, D. Yu. ... 1987. ... 212-222 .1988. ... Journal of Solid State Chemistry. ... 1992. ... 2005. ... 119-138.1989. ... J. Solid. ...

Еще в разделе: (Показать все результаты (>35) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/staff/elbel.php
• http://cryst.geol.msu.ru/literature/2003.php
• http://cryst.geol.msu.ru/literature/lit_dudnik.php

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>2) - tex.bog.msu.ru/ )

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>4) - vernov-relec.sinp.msu.ru/ )

... Новости . ... Математический семинар Глобус. 11 марта 2004 г. версия для печати . 11 марта 2004 года (четверг) в 15:40 в конференц-зале НМУ, Б. Власьевский, 11 состоится очередная лекция семинара Глобус "Random walks along orbits of chaotic maps". ... Consider a random walk. A point x\in T^d jumps to the image fx with probability p(x) and into the preimage f^{-1}x with probability 1-p(x). ... MMOnline . ... 21 июня Магистратура мехмата МГУ проведет День открытых дверей . ... Новости МГУ . ...

Еще в разделе: (Показать все результаты (>83) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантура в США
• Математический семинар Глобус. 11 марта 2004 г.
• MMOnline | Форумы | Аспирантура | Аспирантура в Англии по машинному обучению

... Advance Conference Program . Advance Conference Program is available for download below: . б б б б б б б б б б б б б б б б б б  ICONO-LAT-2013-program.pdf . Conference Technical Digest . The Conference Technical Digest, which is distributed among the conference participants on CD ROM, is available for download from the link below: . б б б б б б б б б б б б б б б б б б  icono-lat-2013-technical-digest.zip . ... Advance program . ... Registration info . ... Contacts . ... Exhibit . ...

Еще в разделе: (Показать все результаты (>5) - iconolat13.phys.msu.ru/ )

• Invited speakers