... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>25) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2015_3.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Studies of the Substorm on March 12, 1991: 1. ... The detailed space-time structure of the disturbance and the relation of the processes of growth phase and beginning of the expansion to the fluxes of auroral ions are studied in the first part of the paper. ... Fig. ... The pressure of low-energy ions of CPS grows with the beginning of the growth phase, transfers the plasma parameter into the region > 1, and after the beginning of the expansion phase the contribution of low-energy ions decreases. ...

Еще в разделе: (Показать все результаты (>95) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/pdf2/scl_open_e.doc
• http://www.kosmofizika.ru/model/obrazec.doc
• http://www.kosmofizika.ru/pdf2/shift_e.pdf

... 2 Telescop e finder Do not rely on that the nominal alignment of coordinate system Auto Alignment made on stars will serve a long time. ... The Meade telesc tages: 1) there is no possibility to common error in the telescope soft system, when telescope moving in ope parking using command :hP# has the following disadvanobtain information on the completion of this procedure, 2) a often leads to tripping-over a limiter and to loss of coordinate a horizontal coordinate system. ... Home Position. ...

Еще в разделе: (Показать все результаты (>20) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_specs.pdf
• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/shtrel_controls.pdf

... 7 / OPTICS LETTERS 1571 Plasmon ruler with gold nanorod dimers: utilizing the second-order resonance Maxim R. Shcherbakov,1 Anton T. Le,1 Natalia Dubrovina,2 Anatole Lupu,2 and Andrey A. Fedyanin1,* 2 Faculty of Physics, Lomonosov Moscow State University, Moscow 119991, Russia Univ. ... As a result, the input polarization state was always set to be parallel to the nanorods. ... This graph straightforwardly indicates the difference between the 1st- and 2nd-order resonances in plasmonic nanorod dimers...

Еще в разделе: (Показать все результаты (>68) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/2013_jetplett.pdf
• http://nanolab.phys.msu.ru/sites/default/files/2013chapter.pdf
• Ultrafast plasmonics and magnetoplasmonics | Laboratory of Nanophotonics &

... One can compare the positions of these singularities and their corresponding singular variables in the Feynman diagrams which contribute to the signal process under consideration, and to both reducible and irreducible backgrounds. ... For a standard analysis using cuts on variables, one should cut hard against the regions of singularities in the background singular variables while keeping the regions with singularities for the signal singular variables (see e.g. [8]). ...

Еще в разделе: (Показать все результаты (>3) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/cms5.ps

A.A. Mailybaev and A.P. Seyranian , . Multiparameter Stability Problems. Theory and Applications in Mechanics , . ... A.P. Seyranian and I. Elishakoff , eds. Modern Problems of Structural Stability , . ... Structural Optimization under Stability and Vibration Constraints , . ... Stability and Catastrophes of Vibrating Systems Depending on Parameters . ... Evan- Ivanowski R.M., eds ), 1993, DE- Vol . ... Optimization. ... System optimization by oscillation and stability criteria . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

• Curriculum Vitae of Prof. Alexander P. Seyranian
• Selected Photos

... О Школе . ... ВШБ МГУ - школе . ... Выпуски журнала . Выпуск 1/2009 Выпуск 1/2010 Выпуск 2/2010 . Выпуск 1/2011 Выпуск 2/2011 Выпуск 1/2012 Выпуск 2/2012 Выпуск 1/2/2013 Выпуск 1/2/2014 Рубрики журнала Информация для авторов Общая структура статьи Информация для рецензентов Контакты . ... Менеджмент Выпуски журнала Выпуск 2/2010 . ... RUSSIAN ECONOMY MODERNIZATION PROBLEMS IN LIGHT OF THE INDUSTRIALIZATION IN ENGLAND (WHAT BUSINESS SCHOOL STUDENTS SHOULD KNOW) . ... Выпуск 1/2010 . ...

Еще в разделе: (Показать все результаты (>65) - www.mgubs.ru/ )

• Выпуск 1/2010 | Высшая школа бизнеса МГУ им. Ломоносова
• Высшая школа бизнеса МГУ им. Ломоносова
• Вестник Московского университета | Высшая школа бизнеса МГУ им. Ломоносова

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• StructAlign help

... A steady gap soliton moves in a periodic structure as an optical soliton does in a homogeneous medium, keeping its shape and constant velocity. ... As a result, if the initial soliton velocity is slow enough, the gap soliton that interacts with the perturbation cannot leave the region of the interaction because its kinetic energy is less than the potential energy of the interaction. ... Evolution of the initial gap 2 pulse (the gray scale is proportional to n). ... This explains the pulse...

Еще в разделе: (Показать все результаты (>27) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/photonics/PDF/4(en).pdf
• http://genphys.phys.msu.su/rus/sci/photonics/PDF/9.pdf
• Микромаг - сервер

... Cell Bio/., ... The mean length of microtubules surrounding the centrosome in different cell lines differed insignificantly and equalled 0.4-0.8 µm. In this case, the microtubules attached to the centrosome were on the average slightly shorter than the free ones. ... Histogram of microtubule distribution by length around the centrosome in cells. radiating outward from the cell center also does not exceed 2 µm. Short microtubules are prevalent: those of 0.2-0.4 µm make up 34% of attached ones. ...

Еще в разделе: (Показать все результаты (>33) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev2002CBI.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva99.pdf

IEEE International Workshop on Intelligent Data Acquisition and Advanced Computing Systems: Technology and Applications 21-23 September 2009, Rende (Cosenza), Italy Web and Grid Services for Training in Earth Observation 1 Marian Neagul, Silviu Panica, Dana Petcu, Daniela Zaharie1, Dorian Gorgan 2 West University of Timisoara, Bd.V.Parvan ... CONCLU SIONS GiSHEO's platform promises to deliver real-time services for satellite data processing for training activities for Earth observation. ...

Еще в разделе: (Показать все результаты (>38) - angel.cs.msu.su/ )

• Appendix D NetCDF 2 C Transition Guide
• Index
• PhD Summer School on Scentific Computing

... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>16) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

. Коуровская тетрадь . Новосибирск . Another list of open problems . New York .

Еще в разделе: (Показать все результаты (>21) - halgebra.math.msu.su/ )

• staff:guterman:publ_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• shared:seminars_lnd | Кафедра высшей алгебры