... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/

... Department of Vertebrate Zoology . ... Vertebrate Zoology - for the 1-year students (prof. L.P.Korzoun) . Special Vertebrate Zoology - elective course for the 2-year students studying zoology and botany (associate prof. S.V.Ogurtsov ) . ... Zoogeography (leading researcher V.V.Inanitskii) . ... Seminar 'Actual Problems of Vertebrate Zoology' - for the 5th year students (leading researcher M.E.Goltsman, researcher O.A.Filatova) . History of Zoology (leading researcher V.S.Shishkin) . ...

Еще в разделе: (Показать все результаты (>13) - vertebrata.bio.msu.ru/ )

• Department of Vertebrate Zoology

звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...

Еще в разделе: (Показать все результаты (>19) - www.bukivedi.ru/ )

• www.99ru.ru - Radiohead 15841

Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...

Еще в разделе: (Показать все результаты (>3) - smu.cmc.msu.ru/ )

Supernova 2005cs in M51 . This page is devoted to information on Supernova 2005cs in NGC 5194 (= M51 ). ... Information on the original web pages for many of these images can be found on the updates and links web pages. Discovered by amateur Wolfgang Kloehr (Germany) [ Translate ]. ... SNWeb has a 2005cs page . ... Sky and Telescope news release on Supernova 2005cs . ... 2005/01/ . ... mirror . W. Kloehr image . ... Joel Nicolas image . ... Wolfgang Kloehr image . ... 2006/01/06.504 . ...

Еще в разделе: (Показать все результаты (>7) - www.rochesterastronomy.org/ )

... Кафедры . ... Krasnoslobodtsev V. P. Territorial availability of higher education in the Northern Caucasus. ... The Northern Caucasus with its relatively favorable demographic structure of population as compared to the rest of Russia is experiencing the profound growth in the availability of higher education. ... In 2007 90% of population of the Northern Caucasus lived within daily distance from higher schools providing mass and prestigious higher education (in law and economics, for example). ...

Еще в разделе: (Показать все результаты (>56) - www.geogr.msu.ru/ )

• Список ссылок
• Список литературы
• КУРСЫ ПО ЦИФРОВОМУ ПОЧВЕННОМУ КАРТОГРАФИРОВАНИЮ

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>3) - www.sciencepark.ru/ )

. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .

Еще в разделе: (Показать все результаты (>3) - cluster.msu.ru/ )

• Литература

About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...

Еще в разделе: (Показать все результаты (>2) - dbserv.sinp.msu.ru/ )

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>13) - lav01.sinp.msu.ru/ )

... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...

Еще в разделе: (Показать все результаты (>5) - monkey.belozersky.msu.ru/ )

... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...

196. Психология XX столетия: итоги. Ресурсы

197. http://savenkov.lvk.cs.msu.su/mc/lect01.pdf