ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...
... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2014_1.doc -- 68.5 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2014_1.doc -- 68.5 Кб -- 23.07.2015 Похожие документы
. Sites . Remove access privilege . You can remove yourself from the Owner, Collaborator, or Viewer list from this site by clicking the "Remove Access" button. Once access is removed it can not be undone by yourself. Remove access . Cancel
. Home . News . Studying at MU . Exchanges . Contacts . Search . Lost your Password? . Please enter your Username and e-mail address then click on the Send Password button. You will receive a new password shortly. Use this new password to access the site. Username: . E-mail Address: . Lomonosov Moscow State University . International Relations Office 2007-2008
... LATTICE DYNAMICS AND PHASE TRANSITIONS Ferroelectric Phase Transition in Orthorhombic CdTiO3 : First-Principles Studies A. I. Lebedev Moscow State University, Moscow, 119991 Russia e-mail: swan@scon155.phys.msu.su Received ... July 4, 2008 Abstract--Parameters of the crystal structure and phonon spectra for orthorhombic cadmium titanate with space group Pbnm and its two possible ferroelectrically distorted phases (with space groups ... RESULTS OF THE CALCULATIONS 3.1. ...
[
Текст
]
Ссылки http://semiconductors.phys.msu.ru/publ/PhysSolidState_51_802.pdf -- 214.2 Кб -- 27.03.2009
[
Текст
]
Ссылки http://scon155.phys.msu.su/publ/PhysSolidState_51_802.pdf -- 214.2 Кб -- 27.03.2009 Похожие документы
Елена Карагодина . ... Среди проблем новых религиозных течений (НРТ) можно отметить несколько таких, которые вызывают особенно острые противоречия, стимулируют развитие антикультового движения и попытки более жесткой законодательной регламентации. ... Очевидно, что нетолерантность к НРТ имеет несколько причин (социальные, культурные, политические, религиозные, психологические). ... Карагодина Е.Г., 1997, 1998 . ... Антикультовое движение в Украине: психологические и правовые основы . ...
Nuclear Instruments and Methods in Physics Research B 230 (2005) 577582 www.elsevier.com/locate/nimb Angular distribution of sputtered particles and surface morphology: the case of beryllium under a krypton beam at various incidences P.-G. Fournier a a,* , A. Nourtier b, V.I. Shulga c, M. Ait El Fqih a,d ґ ґ ^ Laboratoire de Spectroscopie de Translation des Interactions Moleculaires, Universite Paris-Sud, Bat. ... The method supplies accurate angular distributions of sputtered particles. ... Nucl. ...
... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы