... Structure and properties of chimeric small heat shock proteins containing yellow fluorescent protein attached to their C-terminal ends. ... Recombinant chimeras of small heat shock proteins (sHsp) HspB1, HspB5, and HspB6 containing enhanced yellow fluorescent protein (EYFP) attached to their C-terminal ends were constructed and purified. Some properties of these chimeras were compared with the corresponding properties of the same chimeras containing EYFP attached to the N-terminal end of sHsp. ...
THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf -- 652.4 Кб -- 02.04.2012 Похожие документы
... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи, базы данных, информационные технологии, технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование , математическое моделирование , вычислительный эксперимент, информатика, методы вычислений, численный анализ, ...
Sternberg astronomical institute activities on site testing programs review Victor Kornilov comprehensive/characterization/of/astronomical/sites > kislovodsk/russia/2010/october/4-9 > Introduction This presentation responds on our activity in 5 last years only, inspite of that in SAI site testing researches have been started many years ago. ... More detailed discussion is devoted to MASS and DIMM measurements processing, some additional effects which were taken in account in last year. ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/VKornilov_site2010.pdf -- 2488.3 Кб -- 18.10.2010 Похожие документы
... Department of Electrical and Computer Engineering, University of Toronto, 10 King's College Road, Toronto, Ontario, Canada M5S 3G4 (Received 14 October 2003; published 20 May 2004) We consider the interaction and stability of gap solitons in a one-dimensional, resonant, photonic crystal with a defect state produced by a linear localized mode, or by an incoherent pump. ... This is consistent with the physical meaning of the linear localized mode. ... Phys. Rev. Lett. ... Lett. ... Phys. Lett. ...
... Structure of Data . ... Catalog . ... In SAI OCL Catalog, we introduce our work on investigation of the Milky Way system of open star clusters. The main goal of our study is a search for new clusters using huge surveys. 168 new clusters have been already discovered by us using J,H,Ks data from 2MASS point source catalog. ... For 141 new clusters, we found their physical parameters using J,H,Ks data from 2MASS catalog and, for a number of clusters, our UBVRI CCD observational magnitudes. ...
... Key words: Mathematical physics, algebraic geometry, quantum groups. ... Major research position at the Higher geometry and topology department of MSU(from 2009) Doctor habilitatus degree in physical-mathematical sciences Адрес: 119991 ГСП-1, г. Москва, Ленинские горы, МГУ, механико-математический факультет, кафедра высшей геометрии и топологии e-mail: dtalalaev@yandex.ru тел: (495) 939 3798 Текущие научные проекты: Семинар по некоммутативной геометрии (ИТЭФ). ... Семинар ИТЭФ . Семинар МГУ . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...
... Advance Conference Program . Advance Conference Program is available for download below: . б б б б б б б б б б б б б б б б б б ICONO-LAT-2013-program.pdf . Conference Technical Digest . The Conference Technical Digest, which is distributed among the conference participants on CD ROM, is available for download from the link below: . б б б б б б б б б б б б б б б б б б icono-lat-2013-technical-digest.zip . ... Advance program . ... Registration info . ... Contacts . ... Exhibit . ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Decision Sciences . Decision Sciences Journal of Innovative Education . ... Dermatologic Surgery . Dermatologic Therapy . ... Development and Change . Development Policy Review . Development, Growth & Differentiation . Developmental Medicine & Child Neurology . Developmental Science . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...
... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...
Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...
Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
International Journal of Inorganic Materials 1 ( 1999 ) 201 207 Approximation of Mulliken charges for the silicon atoms of all-siliceous zeolites q 1 A.V. Larin , D.P. Vercauteren* ґ Institute for Studies in Interface Sciences, Laboratoire de Physico-Chimie Informatique, Facultes ... In this paper, we will discuss several approximations of the Mulliken charges for the zeolite silicon atoms calculated with the same basis sets as already used previously for oxygen [7]. ...