... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

... To save time, I will only provide ephemerides in 2000 coordinates. ... Note: most the orbital elements used to create these ephemerides were obtained from the International Astronomical Union Circulars (IAUCs), Minor Planet Circulars (MPCs) or the ICQ Comet Handbook. ... The following 1-day ephemeris (March 1, 1997 - October 1, 1997) is from Donald Yeomans of JPL and is based on Reference Orbit #55 (March 4, 1997). 2000 coordinates (March - September, 1997) [3/4/97] . ... Epoch: 1997 Feb. 1.0 . ...

Еще в разделе: (Показать все результаты (>29) - www.issp.ac.ru/ )

• International Olympiad of Euro-Asian Astronomical Society
• Founding Statutes
• Institutes of Chernogolovka

... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>15) - dis.bio.msu.ru/ )

... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Symposia

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

... P hysics Faculty, Moscow State University, . ... Moscow State University, Physics Faculty, Diploma work in Hydrodynamics . ... Title: «Dynamical Stochasticity of Nonlinear Systems and a Prediction Problem» . ... The First International School-Conference BILLIARDS’09 – « Mathematics and Physics of Billiard-Like Systems », February 16-19, 2009, guas de Lindoia, SP, Brazil . ... Invited Lectures «Chaos in Dynamical Systems», The Space Research Institute, Russian Academy of Science, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>83) - chaos.phys.msu.ru/ )

... September, 2005 . ... Moscow State University Russian Language Centre . ... Learn Russian at the Moscow State University! New academic year at MGU . ... You will not only learn Russian for your professional career, but also learn a lot about Russia and its people that will allow you to communicate with your Russian clients more efficiently. www.rlcentre.com . ... Russia's first 24-hour English-language news channel, Russia Today, launched its trial broadcast in September. (more.. ...

Еще в разделе: (Показать все результаты (>24) - www.rlcentre.com/ )

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>99) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/Quantum%20Electronics%2035(1)%2080.pdf
• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

. ESO Telescopes (La Silla Observatory, Paranal Observatory, Space Telescope - ECF) . Fourmilab Switzerland - A variety of documents, images, software for various machines, and interactive Web resources are available here. INSTITUT DE MECANIQUE CELESTE . Stockholm Observatory , GRB99 Photo-Gallery , Free Time . Swedish 1-m Solar telescope . WARSAW UNIVERSITY ASTRONOMICAL OBSERVATORY . Department of Meteorology and Geophysics, Innsbruck University, Austria .

Еще в разделе: (Показать все результаты (>28) - astrometric.sai.msu.ru/ )

• Other Russian Universities and Institutes

. Skip to main content . Образовательная система Аграрного центра МГУ . ECFS . Login Register . RU EN . Page path . Home / x25BA; . Site pages / x25BA; . Сайт Евразийского центра по продовольственной безопасности . Click http://ecfs.msu.ru/ link to open resource. ECFS . +7 (495) 3334-65-56 . info@ecfs.msu.ru

195. Summary of Graduate Introduction to Intercultural Management and Organizations

196. http://science.chem.msu.ru/index.php?view=article&catid=34%3Anews&id=144%3A2013-10-24-11-52-14&format=pdf&option=com_content&Itemid=57

197. Prof. Dolgikh group. Publications 1995-1999

198. MSM 2007

199. Dr Alexei A. Mailybaev

200. Project description | Siberian Lang