... Control of the Self Assembly Processes in a Droplet of a Colloidal Solution by an Acoustic Field O. V. Rudenkoa, P. V. Lebedev Stepanovb, V. A. Guseva, A. I. Korobova, B. A. Korshaka, N. I. Odinaa, M. Yu. ... The self assembly in the course of solvent evapora tion occurs owing to capillary forces, which displace the particles in the near surface layers of the solution as the volume of the latter decreases. ... For simplicity, we replace the actual droplet on a solid substrate by a plane liquid layer...

Еще в разделе: (Показать все результаты (>45) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/polosa3.pdf
• A.V.Shanin

- .. , . . , . (e-mail: soc@soc.pu.ru) , , , , - , knowledge, information, socio-economic approach, public welfare , , . "" " " - . , . This article is devoted to the socio-economic problem of definiteness of information and knowledge in modern society. Theoretical approaches to reveal the content of such categories as "knowledge" and "information" are analyzed. The special attention is devoted to an explanation of the key features of knowledge as public welfare.

Еще в разделе: (Показать все результаты (>79) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/3/21.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/1/02.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/18.pdf

... This is a photometric data reduction program. Currently it works under MS DOS only! ... Correction of the data for the atmospheric extinction; . ... using special observations of standard stars, and . using comparison stars observations (under some conditions); . ... The distribution includes the manual in LaTeX and DVI format (in Russian only...), examples of data files and the binary. ... All above files are stored is a self-extracting archive file for MS DOS, which you can get right away. ...

Еще в разделе: (Показать все результаты (>46) - uranus.sai.msu.ru/ )

• Linux on CLEVO 8750
• Tatjana Khruzina
• Index of /~kts/said/serg

... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...

Еще в разделе: (Показать все результаты (>23) - hit-conf.imec.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...

Еще в разделе: (Показать все результаты (>108) - www.mgubs.ru/ )

... BMC Genomics 2013, 14:745 http://www.biomedcentral.com/1471-2164/14/745 DATABASE Open Access RegPrecise 3.0 ­ A resource for genome-scale exploration of transcriptional regulation in bacteria Pavel S Novichkov1*, Alexey E Kazakov1, Dmitry A Ravcheev2,3, Semen A Leyn2, Galina Y Kovaleva1,2, Roman ... Inna Dubchak1 and Dmitry A Rodionov 2,3* Abstract Background: Genome-scale prediction of gene regulation and reconstruction of transcriptional ... Figure 5 The regulog page in RegPrecise. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

1, 120102 (2012) 2D- - . ... 2D- - E-mail: kozlov@polly.phys.msu.ru 2012 120102-1 [4, 7], . ... 2D- - 1, 120102 (2012) 1D- , x n+1 . ... 5: (), ( ) P () a = 1.9 = 0.1 t = 10000 . ... 2] Kaneko K. Chaos. ... E-mail: kozlov@pol ly.phys.msu.ru In the field of synchronization processes coupled map lattices (CML) represent paradigmatic models of extended systems exhibiting spatiotemporal chaos, self-organization and synchronization due to the rich variety of global qualitative behavior. ... 2012 120102-8 ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

• http://uzmu.phys.msu.ru/issue/120101.pdf

... Application of Artificial Neural Networks to Solve Problems of Identification and Determination of Concentration of Salts in Multi Component Water Solutions by Raman Spectra1 S. A. Burikova, S. A. Dolenkob, T. A. Dolenkoa, and I. G. Persiantsevb a Department of Physics, M.V. Lomonosov Moscow State ... Some statistics for NN determination of concentrations of salts in multi component solutions by Raman spectra within the "experiment based" and "quasi model" approaches. ...

Еще в разделе: (Показать все результаты (>27) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Using.pdf
• http://rswater.phys.msu.ru/en/articles/2013/opt%20mem.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... Студенты, обладающие визой F-1 в Соединенных Штатах Америки , теперь могут сделать изменения, объявленные в апреле, в программе Общего практического обучения. Срок программы обучения был продлен от 12 месяцев до 29 и теперь позволяет определенным студентам визы F-1 работать в США по профессиям, относящимся к области обучения студентов. ... Data Processing and Data Processing Technology/Technician. ... Architectural Engineering Technology/Technician. ... Civil Engineering Technology/Technician. ...

Еще в разделе: (Показать все результаты (>390) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: 7 апреля компания WebScan Technologies представила
• Клуб выпускников МГУ: КАК ОБОСНОВАТЬСЯ В КАНАДЕ: ПЕРВЫЕ ШАГИ (часть 15,
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3343.pdf
• http://library.biophys.msu.ru/PDF/3341.pdf

THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...

Еще в разделе: (Показать все результаты (>17) - www.protein.bio.msu.ru/ )

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>6) - physelec.phys.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

Еще в разделе: (Показать все результаты (>9) - adept.srcc.msu.ru/ )

• Динамическое задание параметров апплета из JavaScript

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>206) - fgp.msu.ru/ )

• featured post п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

Lomonosov Moscow State University Biological faculty Botanical garden (Russia) (http://botsad.msu.ru/eng_news.htm) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The second information message Dear colleagues! ... Educational and enlightening activities based on collections of genus Iris L. The program of the Symposium will consist of plenary and sectional sessions as well as poster presentations. ...

Еще в разделе: (Показать все результаты (>7) - botsad.msu.ru/ )

• http://www.botsad.msu.ru/docs/eng_iris1.doc

... Generation of recombinant antibodies and means for increasing their affinity. ... For example, application of recombinant technologies resulted in antibody preparation of high affinity significantly exceeding the initial affinity of natural antibodies. In this review we summarize information about the structure, modes of preparation, and application of recombinant antibodies and their fragments and also consider the main approaches used to increase antibody affinity. ...

Еще в разделе: (Показать все результаты (>27) - biochem.bio.msu.ru/ )

• Carnosine as a natural antioxidant and geroprotector: from molecular mechanisms

... Agriculture University, 6700 EV Wageningen, The Netherlands ( author for correspondence) Accepted 22 May 1998 Key words: mathematical model , methanogenesis, partial derivatives, sulphate reduction, UASB reactor Abstract The existing mathematical models of sulphate fed anaerobic reactors are reviewed ... 1994; Vavilin et al. ... Existing mathematical models of sulphate fed reactors The first model of sulphate fed anaerobic reactors was developed by Gupta et al. (1994) for a chemostat. ...

Еще в разделе: (Показать все результаты (>125) - www.enzyme.chem.msu.ru/ )

• General Information
• Vyacheslav V
• PubMed medline query