... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>4) - tukachev.flogiston.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Еще в разделе: (Показать все результаты (>153) - www.chem.msu.ru/ )

• THE EFFECT OF CATALYST ON INTERMOLECULAR HETEROGENEITY DISTRIBUTION IN

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>4) - swx.sinp.msu.ru/ )

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>24) - ferro.phys.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>40) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf

... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>23) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_3.doc

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

International Journal for Parasitology 32 (2002) 817-824 www.parasitology-online.com Host manipulation by Ligula intestinalis: a cause or consequence of parasite aggregation? ... Here we consider whether these behavioural changes are important in shaping the distribution of parasite individuals across the fish population. ... Keywords: Ligula intestinalis; Roach; Macroparasitic aggregation; Host manipulation 1. ... Inference of parasite-induced host mortality from distributions of parasite loads. ...

Еще в разделе: (Показать все результаты (>36) - ecology.genebee.msu.ru/ )

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf
• http://antares.sinp.msu.ru/docs/2010_Amsterdam_Kulikovskiy.pdf

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>26) - hit-conf.imec.msu.ru/ )

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>12) - suny.msu.ru/ )

... include stdio.h # include stdlib.h int main( int argc, const char* argv[]) { FILE* f; int c, wordCnt = 0, inWord = 0; if (argc 2) { printf ( Use: %s filename\n , argv[0]); return 1; } f = fopen(argv[1], r ); if (f == NULL) { printf ( Can't open file: %s\n , argv [1]); return 1; } while ((c = fgetc(f)) if (!isspace(c)) if (! inWord ) { ++wordCnt; inWord = 1; } } ... int main() { enum {RUNNING, STOPPED} state; state = RUNNING; state = STOPPED; } RUNNING STOPPED · : 1. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect04.pdf

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>28) - foroff.phys.msu.ru/ )

International Laser Center of MSU . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... In our work we have obtained analytical expressions, which describe the distributions of intensity and polarization in the cross-section of a second-harmonic (SH) light beam. It is found that the polarization state drastically changes along the cross-section of the signal light beam. ...

Еще в разделе: (Показать все результаты (>95) - ilc.phys.msu.ru/ )

• Публикация
• Grant detail

... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>5) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

• SINP MSU