... Letter of Application . ... Minilecture: How to organise information in the letter of application. When one applies for a position in a company, the letter of application cannot and should not contain all the information a prospective employer wants to know about you. ... If you know about a job opening within the company, refer directly to that position; if some person from that company told you of the job opening, you may begin the first paragraph by mentioning this person by name. ...

Еще в разделе: (Показать все результаты (>13) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

In the first part of the book, a systemic concept of algal diversity is lais out. ... On this basis, a functional model of aquatic ecosystem is worked out and the critical levels of its development are defined. ... Second part of the book is a data base for algal species used as ecological markers (3193 species of algae). ... ALGAL INDICATORS AS ENVIRONMENTAL QUALITY. ... PART I. METHODOLODICAL ASPECTS OF BIOLOGICAL DIVERSITY ANALYSIS OF ALGAE . ... Critical state of aquatic ecosystem (P.39) . ...

Еще в разделе: (Показать все результаты (>137) - herba.msu.ru/ )

• The variability of different Drosera
• Morphological differences of Nymphaea alba L
• Alders in the European Russia

... It is found by means of rigorous calculations and scanning near-field optical microscopy that SPP excitation direction depends on the direction of circularly polarized illumination E -vector rotation. ... A SNOM setup for experimental observation of handedn ess-sensitive SPP emission Figure 3 shows optical near-field signal as measured with the SNOM in the vicinity of a nanohole ensemble sample with left-handed and right-handed circularly polarized backside illumination. ...

Еще в разделе: (Показать все результаты (>86) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/ol40_1571_2015.pdf
• http://nanolab.phys.msu.ru/sites/default/files/ppur4z-prb78_193102_2008.pdf
• http://nanolab.phys.msu.ru/sites/default/files/dd15_shilkin.pdf

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - hpc.cs.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... From May 15 to June 15 (2014), the design centre ?Artplay? hosts ?Robot ball? which represents an International Meeting of Modern Robots (official website: balrobotov.ru ). ... In order to participate in the ?Robot Ball?, more than 40 robots arrived in Moscow from USA, France, Germany, UK, South Korea, Japan, Russia, Canada, etc. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>30) - talant.msu.ru/ )

• admin | The Department of Talented Youth Affairs and Professional Orientation
• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation |

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )

... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....

Еще в разделе: (Показать все результаты (>23) - seac47-2.phys.msu.ru/ )

SOLID SOLUTIONS IN THE REALM OF MINERALS V. S. URUSOV A majority of minerals is not pure substances, but complex mixtures - solid solutions. ... унй нДдйЦ нЗЦкСхЦ кДлнЗйкх? 54 ї м ЫТУ, З.л., 1996 , , -, , -, . лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <11, 1996 ( ) . ... Fe (Mn, Co, Ni) ZnS Zn FeS. ... мкмлйЗ З.л. нЗЦкСхЦ кДлнЗйкх З еакЦ еазЦкДгйЗ 55 . ... 4]. дДд Згаьын нЦеиЦкДнмкД а СДЗгЦзаЦ зД ийЗЦСЦзаЦ нЗЦкСхп кДлнЗйкйЗ? , , (), , , 1 , 0њ. / () 58 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <11, 1996 . ...

Еще в разделе: (Показать все результаты (>42) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

... Then cucumber plants were harvested and subjected to measuring shoots and roots length and weight and chlorophyll content. ... The influence of commercial iron chelate Fe-EDDHA parent humic material K-Sh and its Feenriched derivative Fe-Sh on cucumber shoots'(a) and roots' (b) weight and length increase. As it can be seen from the Figure 1, plants treated with Fe-EDDHA or Fe-Sh possessed higher weight and length of both shoots and roots as compared to blank. ...

Еще в разделе: (Показать все результаты (>98) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss/pdf/10th%20nordic%20chapter.pdf
• http://www.mgumus.chem.msu.ru/arw/natocamera-ready.doc
• http://www.mgumus.chem.msu.ru/publication/2002/balcke-adsorption-02.pdf

Pod-Moscowny . Moscow-Regional) . Branch . ... Moscow State University . Page in Russian . Moscow-Regional Branch of M.V.Lomonosov Moscow State University was founded in 1996 in Chernogolovka , town for science and education, placed in 40 km to the North-East from Moscow-city border. Chernogolovka today is considered to be one of the most important Russian scientific and educational centers in physics and chemistry . ... Branch of Moscow State University, . ... Russian Federation . ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

... This study examined the role of plasma lipids in the regulation of erythrocyte membrane viscosity, oxy-Hb content as well as Na+/H+ exchange and Ca2+-ATPase, whose activities are altered in patients with CVD. Both oxy-Hb content and erythrocyte membrane fluidity were decreased in essential hypertension and coronary artery disease patients and negatively correlated with plasma cholesterol but not triglyceride content. ...

Еще в разделе: (Показать все результаты (>41) - www.msm.biophys.msu.ru/ )

• MSM 2007
• Modern spectroscopy methods

. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .

Еще в разделе: (Показать все результаты (>3) - cluster.msu.ru/ )

• Литература

About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...

Еще в разделе: (Показать все результаты (>4) - dbserv.sinp.msu.ru/ )

... Variables representing the environmental conditions were `food' and `infection'. ... APPENDIX 1 An example of optimal life -history traits values (for a = 1.7 and m = 0.9) t 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ... 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z Et 2.3 2.5 2.7 2.8 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.8 3.9 4.0 4.0 4.1 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 ...

Еще в разделе: (Показать все результаты (>27) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1997_Scientometrics.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1998_Repair_EvolEcol.pdf

... 4, No. 5 (2006) 1033­1056 c Imperial College Press RECOGNITION OF TRANSMEMBRANE SEGMENTS IN PROTEINS: REVIEW AND CONSISTENCY-BASED BENCHMARKING OF INTERNET SERVERS NATALIYA S. SADOVSKAYA Institute for Information Transmission Problems, Russian Academy of Science Bolshoi Karetny per. ... Landolt-Marticorena C, Williams KA, Deb er CM, Reithmeier RA, Non-random distribution of amino acids in the transmembrane segments of human typ e I single span membrane proteins, J Mol Biol 229(3):602­608, 1993. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/batmas30.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf

The Apache HTTP Server provides a mechanism for storing information in named variables that are called environment variables . ... For additional flexibility, the directives provided by mod_setenvif allow environment variables to be set on a per-request basis, conditional on characteristics of particular requests. ... As discussed above, the environment passed to CGI scripts includes standard meta-information about the request in addition to any variables set within the Apache configuration. ...

Еще в разделе: (Показать все результаты (>52) - neptun.sai.msu.ru/ )

• Apache Tutorial: Dynamic Content with CGI
• International Customized Server Error Messages
• Manual Page: htpasswd - Apache HTTP Server

... The principal possibility of solving this problem is shown. Use of neural network architecture let to detect fluorescence of nanodiamonds against the background autofluorescence of egg white with high accuracy - better than 3 ug/ml. International Science Index Vol:8, No:10, 2014 waset.org/Publication/9999549 Keywords--Artificial neural networks, fluorescence, data aggregation. ... Thus, fluorescence spectra of nanoparticles and egg white are largely overlapping structureless bands. ...

Еще в разделе: (Показать все результаты (>24) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2013/opt%20mem.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

ISTITUTO NAZIONALE DI FISICA NUCLEARE Sezione di Genova INFN/TC-06/14 October 17, 2006 A FIBER OPTIC AIR BACKED MANDREL HYDROPHONE TO DETECT HIGH ENERGY HADRONIC SHOWERS IN THE WATER M.Anghinolfi1, A.Calvi3, A.Cotrufo3, M.Ivaldi1, O.Yershova2, F.Parodi1, D.Piombo1, A.Plotnikov2 and L.Repetto3 1) INFN-Sezione di ... UniversitЮ degli Studi di Genova, Dipartimento di Fisica Via Dodecaneso 33, I-16146 Genova, Italy Abstract We have studied the design of an air-backed ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%203.pdf
• http://antares.sinp.msu.ru/docs/Ershova%20-%20Acoustic%20field%20eng.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf

... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...

Еще в разделе: (Показать все результаты (>5) - www.phys.msu.ru/ )

• Faculty Staff