... Terrestrial ecosystems . Research . ... Environmental pollution and protection in the Norwegian-Russian border area are the main themes of research cooperation between the Soil Science Faculty of Moscow State University (MSU) and the Norwegian Forest Research Institute (NISK). ... The bilateral scientific cooperation between Norway and Russia was established in 1988, based on joint governmental agreement on environmental problems. ... Norwegian Forest Research Institute, Norway . ...

Еще в разделе: (Показать все результаты (>25) - eco.soil.msu.ru/ )

• Forest Soil Response to Acid Deposition
• Forest ecosystem data in Norwegian-Russian border area
• WEATHERING RATE AND SOIL SOLUTION CHEMISTRY

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>9) - astrometric.sai.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

GCVS Variability Types and Distribution Statistics of Designated Variable Stars According to their Types of Variability ======================================================================== I. GCVS Variability Types. ... Amplitudes usually do not exceed 0.1 mag. ... RR Variables of the RR Lyrae type, which are radially-pulsating giant A-F stars having amplitudes from 0.2 to 2 mag in V. Cases of variable light-curve shapes as well as variable periods are known. ... RV Variables of the RV Tauri type. ...

Еще в разделе: (Показать все результаты (>80) - sai.msu.ru/ )

• http://www.sai.msu.ru/gcvs/gcvs/iii/vartype.txt
• General Catalogue of Variable Stars: Variability Types
• Future Prospects of Variable-Star Catalogues

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>6) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf

... Probable participation of 14-3-3 in tau protein oligomerization and aggregation. ... This review is focused on universal adapter proteins 14-3-3 that seem to be significant partners to tau protein in neurons. 14-3-3 interacts with nonphosphorylated tau and promotes its interaction with and phosphorylation by a number of protein kinases. 14-3-3 induces aggregation of nonphosphorylated tau and does not affect aggregation of tau phosphorylated at specific sites. ...

Еще в разделе: (Показать все результаты (>65) - biochem.bio.msu.ru/ )

• [The use of immobilized ubiquitin for biosensor analysis of the mitochondrial
• Oxidative stress induced in rat brain by a combination of 3-nitropropionic acid
• The effects of endogenous non-peptide molecule isatin and hydrogen peroxide on

... Brykina I. G. Methods for calculation of heat transfer and skin friction in 3D hypersonic laminar flow over bodies at all Reynolds numbers. ... Sakharov V. I. Simulation of nonequilibrium viscous gas flows in induction plasmatrons and over bodies. ... Shcherbak V. G. Numerical study of nonequilibrium air flow over bodies. ... Tirskiy G. A. Destruction of solid bodies in the hypersonic gas flow. ... Rusakov V. V. Analytical and numerical investigation of 3D viscous flow over blunt bodies. ...

Еще в разделе: (Показать все результаты (>9) - lab106.imec.msu.ru/ )

... Prof, head of the laboratory of x-ray diffraction and crystal chemistry Home address: Russia, 115470, Prosp. ... 1964-1969 a student of Geological faculty MSU, department of crystallography 1969-1973 a post graduate student (scientific advisor academician N.V.Belov) 1974 Ph.D., speciality 'Crystallography and Crystalphysica', title of Ph.D. Thesis 'Crystal structures of (Na,Cd)-germanates' 1994 D.Sc., speciality 'Physical chemistry', title of D.Sc. ... E.L.Belokoneva, L.I.Leonjuk, V.S.Urusov. ...

Еще в разделе: (Показать все результаты (>38) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/history/70let.pdf
• http://cryst.geol.msu.ru/courses/aspmk/article02.pdf
• http://cryst.geol.msu.ru/courses/crchem/urusov1.pdf

... 6, February, 2015 SESSIONS OF THE WORKSHOP OF THE MATHEMATICS AND MECHANICS DEPARTMENT OF LOMONOSOV MOSCOW STATE UNIVERSITY, "URGENT PROBLEMS OF GEOMETRY AND MECHANICS" NAMED AFTER V. V. TROFIMOV D. V. Georgievskii and M. V. Shamolin UDC 51(09) (For the b eginning of the list of sessions see J. Math. ... For these coefficients, we construct a recurrent system of ordinary differential equations. ... Some problems of microp olar elasticity theory. ... Stability of nonconservative mechanical systems. ...

Еще в разделе: (Показать все результаты (>55) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-98-1.pdf
• http://shamolin2.imec.msu.ru/art-134-1.pdf
• http://shamolin2.imec.msu.ru/art-160-1.pdf

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>2) - tex.bog.msu.ru/ )

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>7) - tunka.sinp.msu.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

193. Pod-Moscowny Branch of Moscow University in Chernogolovka, Home page

194. Proceedings

195. Introduction to Linux

196. SAI Open Star Clusters (SAI OCL) Catalog

197. http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

198. http://lab110.imec.msu.ru/Documents/General/Lab_results.pdf

199. http://geophys.srcc.msu.ru/library/wind_stress.pdf

200. Поведенческие реакции рыб на болевые стимулы