... Поздравляем профессора кафедры М.А.Носова с присуждением ему премии международной академической издательской компании Наука/Интерпериодика за лучшую публикацию в издаваемых ею журналах! . 02.11.2015 . 11-13 ноября 2015 г. в ИПМех РАН пройдет Международная научная школа молодых ученых Физическое и математическое моделирование процессов в геосредах . ... Интервью зав. кафедрой К.В.Показеева: . 2002-2016, Кафедра физики моря и вод суши . ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...
... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... 2000 December 15 . IC443's Neutron Star . ... Explanation: Using x-ray data from the orbiting Chandra Observatory along with radio data from the Very Large Array , a team of researchers has discovered evidence for a new example of one of the most bizarre objects known to modern astrophysics -- a neutron star . ... The core collapsed when the star, located a reassuring 5,000 light-years away in the constellation Gemini , exploded long ago. How long ago? ... About APOD | ... NASA Technical Rep.: ...
SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...
[
Текст
]
Ссылки http://matematika.phys.msu.ru/files/seminar/189/Naidu_SPaTS_Presentation_MoscowStateUniversity_2012_06_23_Abstract+and+Biography.pdf -- 98.8 Кб -- 14.06.2012 Похожие документы
... Вы находитесь на сайте кафедры теоретической физики физического факультета МГУ им. М.В. Ломоносова. Здесь Вы можете получить разнообразную информацию о сотрудниках, читаемых курсах лекций, познакомиться с историей кафедры. О кафедре . ... Кафедра теоретической физики физического факультета МГУ им. М.В. Ломоносова, 2006 ...
... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...
Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...
... Optical forces induced by Blo ch surface waves on a one-dimensional photonic crystal Shilkin D.A.1, Lyubin E.V.1 , Sob oleva I.V.1,2, Fedyanin A.A.1 1 Faculty of Physics , Lomonosov Moscow State University, 119991 Moscow , Russia 2 A.N. Frumkin Institute of Physical Chemistry and Electro chemistry, Russian Academy of Science, Moscow 119991, Russia e-mail: fedyanin@nanolab.phys.msu.ru Blo ch surface waves ( BSW ) are ...
... Research . ... Scientific Laboratories . ... History of the Lab goes back in 70th of the last century, when two outstanding professors of theoretical physics, Prof. Rouslan L. Stratonovich and Prof. Yuri L. Klimontovich, working with the Chair of General Physics and Wave Processes, Department of Physics, Lomonosov Moscow State University, moved into the room No. 3-06 of just-launched Nonlinear Optics Building and formed a core of the theoretical lab (along with other theory-like labs at the chair). ...
. [ Войти ] . Главная -> Фильмы -> Creature Feature: 50 Years o.. Пользователи . Демо . Деньги . Фильмы . Форум . Creature Feature: 50 Years of the Gill-Man . США 2004 . отметить . Документальный .
... Вниманию аспирантов! ... Вниманию аспирантов (группа проф. Хмелевской С.А.)! Семинар по истории и философии науки 30 марта отменяется. ... Вниманию аспирантов первого года обучения! ... Лекции по истории и философии науки будут читать проф. Яковлев В.А. по пятницам в 12:30, ауд. 5-18 (первое занятие 18 марта) и проф. Волкогонова О.Д. по понедельникам в 15:20, СФА (первое занятие 14 марта). ... Семинары по истории и философии науки будут проходить по вторникам в 17:00, ауд. ... Вниманию аспрантов! ...
News of PARALLEL.RU par-news на mail.parallel.ru . Вт Авг 11 11:54:19 MSD 2009 . Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [21/08/2009] . ... Выпуск 269 . 11 августа 2009 г. ------------- Д.Медведев: Россия будет вкладывать средства в суперкомпьютеры. http ://top.rbc.ru/society/28/07/ 2009 /318377.shtml ------------- Опубликована предварительная научная Программа Всероссийской суперкомпьютерной конференции Научный ... Подробная информация о списке рассылки par-news . ...
... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...
Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/reportofinvention.doc -- 166.5 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/reportofinvention.doc -- 166.5 Кб -- 27.10.2005 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
MEMORANDUM OF UNDERSTANDING BETWEEN THE FACULTY of FUNDUMENTAL MEDICINE at the M.V. LOMONOSOV MOSCOW STATE UNIVERSITY ("MSU FFM"), RUSSIAN FEDERATION and the Institute for Cardiovascular Research at the State University of New York, UPSTATE MEDICAL UNIVERSITY, in Syracuse, ny, US ("SUNY ICR") | ... Faculty and researcher exchanges; | ... Clause 1. ... MSU FFM and SUNY ICR have expressed interest in jointly developing a | ... MSU FFM and SUNY ICR express joint interest in exchanging faculty | ...
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Shmeleva Elena Vladimirovna . ... Research interests - strategic and corporate governance, culture of innovation, HSE-management, talent management, corporate social responsibility, quality management system of higher education. ... The head of more than 200 research projects. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...