. Наземные станции . Оборудование . Текст о наземных спутниковых станциях, которые использует сеть Радио-МГУ, будет здесь несколько позже.

Еще в разделе: (Показать все результаты (>3) - www.radio-msu.net/ )

... Number of required sensors is 10000 4 The part of ANTARES collaboration (http://antares.in2p3.fr/Collaboration/index.html) 5 The some direction of MSU group activity in the project · Bioluminescence cut · Quality cuts · SN search 6 Bioluminescence cut We have collected distributions of hit counts for each PMT during one K40 run (~45min) Usually these distributions consist of 2 parts ­ Poissonian (due to K40 and plankton ... Conclusion Bioluminescence cut was done. ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf
• http://antares.sinp.msu.ru/docs/MAM%202011%20-%20Katya.pdf

new-mac ]] . ... Instructions for Installing CompHEP under OSX . ... Be aware, that Mac OS ix not Linux, installation of any GNU (or GNU-based) software can cause problems! ... go to Fink ( http://fink.sourceforge.net/ or any other GNU software repository), download the fink application and БЂњFink CommanderБЂќ, and then use this to download the binary files for: gfortran (fortran 77 compiler) . download the last version of the software from the comphep web site, http://comphep.sinp.msu.ru . ...

Еще в разделе: (Показать все результаты (>12) - comphep.sinp.msu.ru/ )

• news [CompHEP]

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>758) - www.hist.msu.ru/ )

• Textbooks and teaching aids
• Moscow State University. Faculty of History. Visiting Scholar's Program

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>9) - photonicslab.phys.msu.ru/ )

• Conferences

Сайт кафедры магнетизма Московского Университета . ... о кафедре . сотрудники . ... Перов Николай Сергеевич . ... E-mail: perov@magn.ru . ... E.A. Gan'shina, A.B. Granovsky, A.F. Orlov, N.S. Perov, M.V. Vashuk 'Magneto-optical spectroscopy of diluted magnetic oxides TiO2: Co' Journal of Magnetism and Magnetic Materials 321 (7) (2009), pp. ... N.S. Perov, P.M. Sheverdyaeva, M. Inoue, Effect of magnetic field on the electrode potential of metals, Journal of Applied Physics, 91 (10)(2002) 8557-8559. ...

Еще в разделе: (Показать все результаты (>32) - magn.phys.msu.ru/ )

• Сотрудники кафедры магнетизма: Родионова Валекрия Викторовна
• Сотрудники кафедры магнетизма: Радковская Анна Александровна

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Publications . Journals . ... Borisov A. V. , Mamaev I. S. , Treschev D. V. Rolling of a rigid body without slipping and spinning: kinematics and dynamics . Russian Journal of Nonlinear Dynamics, 2012, vol. 8, no. 4, pp. ... Borisov A. V., Mamaev I. S., Treschev D. V., Rolling of a rigid body without slipping and spinning: kinematics and dynamics, Russian Journal of Nonlinear Dynamics, 2012, vol. 8, no. 4, pp. ... ISSN (print): . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>123) - ics.org.ru/ )

• Institute of Computer Sciences - Conferences - Sixth International Conference

Title Author The Past, the present and the future of the sociological theory in Russia Osipova N.G Theoretical bases of sociological discipline ; the subjective approach in sociology ; antipositivism; degradation of the general sociological theory ; methodological empiricism; the theoretical theory , system of co-ordinates of the scientific ... Key words Abstract ...

Еще в разделе: (Показать все результаты (>41) - www.socio.msu.ru/ )

• Вестник МГУ
• English version - Социологический факультет МГУ

... These differences provide 100% reliability of sexing by a single call. ... We received data on individual differences for captive white-faced whistling ducks (94% correctly assigned calls for 14 birds); for captive red-breasted geese Branta ruficollis (85,6% correctly assigned calls for 22 birds), for free-living spotted ground squirrels Spermophillus suslicus (96% correctly assigned calls for 13 animals) and for captive dholes Cuon alpinus (96% correctly assigned calls for 6 animals). ...

Еще в разделе: (Показать все результаты (>61) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>11) - bioinf.fbb.msu.ru/ )

• Prot-DNA-Korr: main page
• SDPlight
• SDPsite

Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...

193. Moscow Summer School: EGMD 2009

194. http://theorphys.phys.msu.ru/education/aqft_slides/Handout_Term2.pdf

195. http://www.antropos.msu.ru/zzx/11_2_en.doc

196. http://nanofluidics.phys.msu.ru/paper/derjaguin.pdf

197. http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

198. Admissions

199. http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf

200. Lora S. Nikolaeva Laboratory of Chemical Thermodynamics