... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... Проблемой времени С.М. Коротаев заинтересовался еще в студенческие годы под впечатлением выступлений Н.А. Козырева, а с 1973 г. начал самостоятельные исследования по приложению причинной механики в геофизике и на этой почве познакомился с Николаем Александровичем лично. ... Коротаев С.М . ... Коротаев С.М., Шабелянский С.В., Сердюк В.О. Обобщенный причинный анализ и его применение для изучения электромагнитного поля в океане // Известия АН Физика Земли, 1992, ?6, С.77-86. ... Korotaev S.M . ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...
... Course Name . ... Software Development for Computational Problems . ... Prof. Fedor S. Zaitsev . Data Analysis Methods . ... Computational Physics and Nanotechnology . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Two-Dimensional Problems of Mathematical Physics . ... Maple for Mathematical Physics Problems . ... Source URL: http://ani.cs.msu.su/en/courses . ...
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...
Lomonosov Moscow State University . ... Academic Programs . ... Academic Departments Programs . ... Russian Language Program . ... There is a well-known fact that if one doesn't know any foreign languages, he has no notion about his mother tongue. ... Moreover, the academic content is connected with the creation of texts in the Russian language relevant to a plan of a speaker and a writer. ... Address: MSU, Faculty of Foreign Languages and Area Studies, Russia, 119192, Moscow, 31/1, rooms 234-235 . ...
... pobedria@member.ams.org . ... Since that time he has read the following courses of lectures: Mechanics of Continuous Media, Numerical Methods, Classical Mechanics, Mechanics of Solids, Theory of Elasticity and Plasticity, Tensor Analysis, Theory of Viscoelasticity, Composites Mechanics, Stability of deformation processes, Mathematical theory of Shells, Dynamic problems of the Composites Mechanics. ... Member of the European Community on Computational Methods in Applied Sciences (ECCOMAS)(1996) . ...
... Advance Conference Program . Advance Conference Program is available for download below: . б б б б б б б б б б б б б б б б б б ICONO-LAT-2013-program.pdf . Conference Technical Digest . The Conference Technical Digest, which is distributed among the conference participants on CD ROM, is available for download from the link below: . б б б б б б б б б б б б б б б б б б icono-lat-2013-technical-digest.zip . ... Advance program . ... Registration info . ... Contacts . ... Exhibit . ...
Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...
... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...
... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...
... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...
... Alexeyev V.L., Levich A.P. A search for maximum species abundances in ecological communities under conditional diversity optimization // Bull. of Mathemat. ... 1997. ... Bendoricchio G., JЬrgensen S.E. Exergy as a goal function of ecosystems dynamic // Ecological modelling. ... 1999. ... Comolli C.J., Donohue C., Timothy J. Pseudomonas aeruginosa RoxR, a response regulator related to Rhodobacter sphaeroides PrrA, activates expression of the cyanide- insensitive terminal oxidase. ... 1995. ... 2000. ...
[
Текст
]
Ссылки http://dis.bio.msu.ru/States/Fursova_Mil'ko_levich/Spisok.pdf -- 167.3 Кб -- 03.12.2009 Похожие документы
ADAPTIVE METHOD OF EYE BLINK ARTIFACT SUPPRESSION IN EEG Chernomorets A.A., Nasonov A.V., Krylov A.S. Lomonosov Moscow State University, Faculty of Computational Mathematics and Cybernetics, Laboratory of Mathematical Methods of Image Processing http://imaging.cs.msu.ru Electroencephalography (EEG) is the neurophysiologic measurement of the electrical activity of the brain recorded by electrodes placed on the scalp. ... In this article, suppression of blink artifacts is considered. ...
[
Текст
]
Ссылки http://imaging.cs.msu.su/pub/2010.DSPA.Chernomorets_Nasonov_Krylov.BlinkEEG.en.pdf -- 71.7 Кб -- 04.04.2010
[
Текст
]
Ссылки http://imaging.cs.msu.ru/pub/2010.DSPA.Chernomorets_Nasonov_Krylov.BlinkEEG.en.pdf -- 71.7 Кб -- 04.04.2010 Похожие документы