... In Chap. ... sign cos : By the theorem on the motion of the center of masses in the space in projections to the related axes .x ; y ; z/ and the theorem on the change of the kinematic moment with respect to these axes, we obtain the following complete system of differential equations in the dynamical quasi-velocity space R1 fvg S2 f; g C R3 fx ;y ;z g: v cos P v sin C y v sin sin P 2 2 z v sin cos C .y C z / D Fx =m; v sin cos C v cos ... I2 n0 d cos with variable coefficient....

Еще в разделе: (Показать все результаты (>26) - shamolin2.imec.msu.ru/ )

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>24) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/139.doc
• http://www.rsr-online.ru/doc/norm/327.doc

... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 ­ ­ ­ ­ ­ (chairman ­ M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...

Еще в разделе: (Показать все результаты (>8) - math.phys.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>209) - observ.pereplet.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• ConClus

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Вакансии . ... Mobile Communications Division . ... Mobile Handset(Product : Samsung Mobile Phone) . ... System performance measurement, optimization, enhancement of key components and additional responsibilities would include participating in continuous efforts to maintain processor cores compatibility with the Linux kernel . ... 2) Knowledge or experience of optimization of toolchains . ...

Еще в разделе: (Показать все результаты (>36) - www.physcareer.ru/ )

• Software Requirements Analyst / Вакансии / Physcareer.ru
• ВАКАНСИИ КАДРОВОГО АГЕНТСТВА АНКОР, компания АНКОР / Вакансии / Physcareer.ru

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...

Еще в разделе: (Показать все результаты (>9) - suny.msu.ru/ )

... The main LanHEP features are: § LanHEP expands expression and combines similar terms ; § it performs the Fourier transformation by replacing derivatives with momenta of particles; § it writes Feynman rules in the form ... example for covariant derivative; § it is possible to define multiplets, and (if necessary) their components; § user can write Lagrangian terms with Lorentz and multiplet indices explicitly or omit indices (all or some of them); § ... It has one vector index. ...

Еще в разделе: (Показать все результаты (>7) - comphep.sinp.msu.ru/ )

... The Vlasov Kinetic Equation, Dynamics of Continuum and Turbulence Valery V. Kozlov * V.A. Steklov Mathematical Institute Russian Academy of Sciences ul. Gubkina 8, Moscow, 119991 Russia Received January 6, 2011; accepted March 3, 2011 Abstract--We consider a continuum of interacting particles whose evolution is governed by the Vlasov kinetic equation. ... The density of the medium is the function of x, u and t. It is non-negative, and (x, u, t) dx du = m is the mass of matter. ... Vol. ...

Еще в разделе: (Показать все результаты (>102) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/702/176-the-dynamics-of-a-rigid-body-with-a-sharp-edge-in-contact-with-an-inclined-surface-in-the-presence-o_ru.pdf
• http://ics.org.ru/upload/iblock/704/186-the-self-propulsion-of-a-body-with-moving-internal-masses-in-a-viscous-fluid_ru.pdf
• http://ics.org.ru/upload/iblock/cfe/194-the-dynamics-of-systems-with-servoconstraints-i_ru.pdf

... Bachelor Program . Master Program . ... The Department of Operations Research . ... researchers specialized in mathematical models and methods of economic regulations . ... possess a profound knowledge in the field of e со nometrics, risk theory, actuarial and financial mathematics, the theory of games, operations research, economic regulation on micro and macro levels . ... can use modern computer technologies in order to construct models and solve optimization problems . ... exam . ... test . ...

Еще в разделе: (Показать все результаты (>7) - io.cmc.msu.ru/ )

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Как правило более точные методы регистрации ионных токов (с помощью электродов) сильнее ограничены по числу одновременно регистрируемых нейронов. ...

Еще в разделе: (Показать все результаты (>6) - photonicslab.phys.msu.ru/ )

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>2) - www.law.msu.ru/ )

... Gen. 38 (2005) 5531­5546 doi:10.1088/0305-4470/38/24/007 Unfolding of eigenvalue surfaces near a diabolic point due to a complex perturbation O N Kirillov, A A Mailybaev and A P Seyranian Institute of Mechanics, Moscow State Lomonosov University, Michurinskii pr. ... In the case of real symmetric matrices we study the unfolding of eigenvalue surfaces near a diabolic point under real and complex perturbations. ... A real non-symmetric perturbation of a diabolic point. c 0: Im2 + (x + )2 + (y + )2 = 2...

Еще в разделе: (Показать все результаты (>28) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/MailybaevSeyranian2001.pdf
• Multiparameter Stability Theory with Mechanical Applications

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) SN detection, V.Kulikovskiy, ANTARES meeting in Amsterdam 22-09-2010 1/14 SN progenitor stars distribution A half of the possible sources of SN type II explosion are at 10kpc. Sensitivity decreases as the square of the distance to SN SN detection, V.Kulikovskiy, ANTARES meeting in Amsterdam 22-09-2010 2/14 Methods overview Single rate 1. exclude OMs affected by bio bursts 2. ...

Еще в разделе: (Показать все результаты (>11) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%201.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf
• http://antares.sinp.msu.ru/docs/NIMA.pdf

... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>32) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/aspmk/article02.pdf
• http://cryst.geol.msu.ru/literature/lit_dudnik.php
• http://cryst.geol.msu.ru/literature/1990.php

О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>3) - geo.phys.msu.ru/ )

... Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #263 [14/04/2009] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + NVIDIA предоставляет пользователям OpenCL Driver. http ://www.nvidia.com/object/io_1240224603372.html + Psychsoftpc выпускает Psychlone Tesla Personal Supercomputer. http ://www.psychsoftpc.com/psychlone_tesla.htm + NSF финансирует участие 14 университетов в программе IBM/Google Cloud Computing University Initiative. http ://www.nsf.gov/ news...

Еще в разделе: (Показать все результаты (>17) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]
• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>11) - nano.msu.ru/ )

• Fundamentals of Nanotechnology, 2009 | MSU Nanotechnology Education and
• Fundamentals of Nanotechnology, 2009 | Научно-образовательный центр по