... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

• Anton O. Belyakov

Division of Experimental and Theoretical Physics . ... Theory of gauge fields and its applications to elementary particle physics . Unified theory of physical effects and phenomena in systems of particles with electromagnetic interaction . ... Methods of Lobachevsky geometry in non-linear problems of mathematical physics . ... Interaction of ultra-short laser pulses with matter, investigations of physical properties of new materials for quantum- and optoelectronic systems . ... Materials science . ...

Еще в разделе: (Показать все результаты (>21) - foroff.phys.msu.ru/ )

• Papers of our group
• Offered courses
• Faculty's Tuition Structure

... education . research . ... Fundamentals of Nanotechnology . ... Molecular physiology . ... Pass/fall exam: 5 p.m., 22 May, 2009 (those third-year students who pass the exam undertake further study majoring in Nanosystems and Nanodevices , Functional Nanomaterials , Nanobiomaterials and Nanobiotechnology). ... 10 February 2009 . ... Prof. Yu. ... Work of molecular motors: ATP synthetase, photosynthetic reaction centers, retinal containing photosensitive proteins (rhodopsin, bacteriorhodopsin.) ...

Еще в разделе: (Показать все результаты (>8) - nano.msu.ru/ )

• Fundamentals of Nanotechnology, 2009 | Научно-образовательный центр по

THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...

Еще в разделе: (Показать все результаты (>16) - www.protein.bio.msu.ru/ )

• Statistics, Electra-physiology, Frequency analysis, Automation

... Assume that gas is a thermodynamic system in the state of local equilibrium, that is, it is satisfied the relation [2] [pic] (1) There [pic],[pic] and [pic] are the temperature, the pressure and the gas volume, [pic], [pic] are entropy and internal energy per unit volume. ... Let us consider the first-degree form [pic]. ... Since the evolutionary relation is not identical, from this relation one cannot get the state differential [pic] that may point to the equilibrium state of the material system. ...

Еще в разделе: (Показать все результаты (>21) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2008/abstractEx.doc

... The enhancement is due to the resonant enhancement of the fundamental field in the cavity mode and the fulfillment of the phase matching condition at the photonic band gap edges of the photonic crystal and in the vicinity of the microcavity mode. ... The resonant THG enhancement was found in angular TH intensity spectra in the vicinity of the cavity mode and at the edges of the photonic band gap. ... Dashed lines indicate the angular shift of the THG resonance from the position of the cavity mode. ...

Еще в разделе: (Показать все результаты (>27) - shg.phys.msu.ru/ )

• Laboratory of nonlinear optics of nanostructures photonic crystals Laboratory

Стратегия здравоохранения относительно загрязнения питьевой воды мышьяком, марганцем, ураном и другими ядовитыми элементами в Западном Бангладеш. ... Для более чем 60 000 000 жителей Бангладеш питьевая вода представляет опасность, так как содержит большие концентрации загрязняющих веществ. ... Исследованы источники питьевой воды в различных регионах западного Бангладеш на содержание мышьяка, бора, бария, хрома, урана и др. химических элементов. ...

Еще в разделе: (Показать все результаты (>13) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=2&subtheme=11&from=0&ref_ind=0303100557
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0407001146

PHYSICAL CONSTANTS OF SOME ELEMENTS ________________ CRC Handbook of Chemistry and Physics, 84th Edition, 2003-2004. 4

Еще в разделе: (Показать все результаты (>65) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/chteniya/f30_vorotyntsev.pdf
• Alexander M. Kuznetsov
• RADEN Data Bank

. Numerical methods of research on heat and mass intensification processes in power units. Book “Numerical simulation of vertical intensification of heat transfer in tube packages” . Numerical simulation results of heat transfer intensification on “eddy generating” surfaces with different turbulence models application. Heat and hydrodynamic pattern at flowing over the cylinder with “eddy generating” elements

Еще в разделе: (Показать все результаты (>4) - termogaz.imec.msu.ru/ )

• por_vduv_e
• scientific results_e

e-mail: ignat@fgo.nstu.ru) .. (e-mail: alest_star@ngs.ru) , , , " ", virtual social action, actual and virtual systems, information resonance, "symbolical another" - . ... The nature of a new level social virtual social space is considered. ... Authors come to a conclusion, that increasing risks, individualization and anomia in a modern society are caused by information resonance and bifurcation of system of social action on actual and virtual. ...

Еще в разделе: (Показать все результаты (>21) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/4/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/1/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/1/07.pdf

The History Faculty at Moscow State University is pleased to invite students from all nations and peoples to consider studying history with us here in Moscow. Moscow State University strives to offer its students as many opportunities as possible for learning more about the world ? ... The History Faculty at Moscow State University is ready to welcome all interested students to make Moscow their home for a period, to study with us, and to reap the benefits of an international education. ...

Еще в разделе: (Показать все результаты (>8) - www.hist.msu.ru/ )

• Textbooks and teaching aids

Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...

Еще в разделе: (Показать все результаты (>31) - www.mgubs.ru/ )

... S = k·log I . ... S S , 1698-1758 . k , 1795-1878 . S S1, - S/S=const. : - const. ... S/S ~ const - S 2- : ? ... 0,25 =0,75 Sj ­ , Si ­ P(S1,S2) = 0,7 S1 S2 S3 S1 S2 S3 P(S2,S3) = 0,8 * 7 6 3 * 8 4 2 * P(S1,S2) = 0,6 S1 S1 S2 7 * S2 3 * S3 4 2 S1 S2 S1 * 0,7 S2 * S3 0,2 0,3 0,4 S3 6 8 * S3 0,6 0,8 S1 S2 * 0,09 * S3 -,090 * Sj - Si = 1,44 * z S1 j,i * 0,52 0,25 -0,52 -,025 S2 S3 . ... 1-15%: , . ...

Еще в разделе: (Показать все результаты (>5) - www.soc-phys.chem.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>13) - antares.sinp.msu.ru/ )

... Notes: Pink Sugar by Aquolina contains ? Bergamot, Sicilian Orange, Raspberry, . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 ...

Еще в разделе: (Показать все результаты (>33) - elana.sinp.msu.ru/ )

• moncler outlet uk Makes the NEWS. A baby boa | С Днем Победы!

... Seismic Nails in Various Geodynamic Conditions V. S. Zakharov, A. I. Karpenko, and S. P. Zav'yalov Faculty of Geology, Moscow State University, Moscow, 119899 Russia e mail: vszakharov@yandex.ru, AlexandroKarpenko@yandex.ru, zasergey@rambler.ru Received May 25, 2012 Abstract--Isometric in plan, near vertical earthquake clusters (seismic "nails") were identified in different regions of the world. ... Some nails are related to strong earthquakes and volcanic erup tions. ... The initial formation was...

Еще в разделе: (Показать все результаты (>20) - dynamo.geol.msu.ru/ )

• Summaries of articles

... An hour later, the satellite has proceeded to higher altitudes and the auroral proton precipitation pattern can be seen, using the SI-12 proton imager. ... The IMF dependence of the proton cusp signature has been described at length recently in several papers by Frey et al. [2002, 2003]. movie of this event This is just the first indication of activity and this storm is a continuing event, now with (a possibly unprecedented) 2 successive dips of DST below -300 nT. ... Proton aurora in the cusp . ...

Еще в разделе: (Показать все результаты (>107) - www.kosmofizika.ru/ )

• Frequently Seen Space/Astronomy Acronyms
• Нейтроны и космическая погода, Кужевский и др.

... Observations of the spatial distribution of the broods of five wader species Grey Plover Pluviulis squatarola, Curlew Sandpiper Calidris ferruginea, Turnstone Arenaria interpres, Knot Calidris canutus, and Sanderling Calidris alba were carried out in 1991 in the northern Central Taimyr, near Knipovich Bay. ... The probability of finding at least two broods in an aggregation decreased in the order Curlew Sandpiper, Turnstone, Grey Plover, Knot, Sanderling. ...

Еще в разделе: (Показать все результаты (>50) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/RJG595_2006Eng.pdf
• http://vertebrata.bio.msu.ru/SINEs_RJG2002Eng.pdf
• Field Practice at the White Sea Biological Station